GtRNAdb

tRNAscan-SE Analysis of Aeromonas hydrophila ATCC 7966

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna88 (3876267-3876192)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (3876234-3876232)	Score: 81.36
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCCGCGGTTCGATCCCGCGTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna89 (3876163-3876088)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (3876130-3876128)	Score: 81.36
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCCGCGGTTCGATCCCGCGTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna90 (3876024-3875949)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (3875991-3875989)	Score: 81.36
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCCGCGGTTCGATCCCGCGTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna91 (3875900-3875825)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (3875867-3875865)	Score: 81.36
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCCGCGGTTCGATCCCGCGTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna92 (3875790-3875715)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (3875757-3875755)	Score: 81.36
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCCGCGGTTCGATCCCGCGTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna50 (4452741-4452666)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (4452708-4452706)	Score: 88.77
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCTGCGGTTCGATCCCGCATAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna53 (4369719-4369644)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (4369686-4369684)	Score: 88.77
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCTGCGGTTCGATCCCGCATAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (216610-216685)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (216643-216645)	Score: 88.77
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCTGCGGTTCGATCCCGCATAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna59 (4142172-4142096)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (4142138-4142136)	Score: 91.00
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGTGGtCAGAGGTTCGAATCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna60 (4141996-4141920)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (4141962-4141960)	Score: 91.00
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGTGGtCAGAGGTTCGAATCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna61 (4141893-4141817)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (4141859-4141857)	Score: 91.00
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGTGGtCAGAGGTTCGAATCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna62 (4141788-4141712)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (4141754-4141752)	Score: 91.00
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGTGGtCAGAGGTTCGAATCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna63 (4141683-4141607)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (4141649-4141647)	Score: 91.00
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGTGGtCAGAGGTTCGAATCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna1 (29246-29322)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (29280-29282)	Score: 95.23
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGCGCTGCCCTCCGGAGGCAGAGGtCACAGGTTCGAATCCTGTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna125 (1187103-1187027)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (1187069-1187067)	Score: 79.52
Seq: GCTCCCGTAGCTCAGTAGGAtAGAGCGGTCCCCTCCTAAGGGACAGGcCACTGGTTCGACTCCAGTCGGGAGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna119 (2027039-2026963)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (2027005-2027003)	Score: 97.39
Seq: GCGCCCTTAGCTCAGTCGGAtAGAGCAACGGCCTTCTAAGCCGTGGGtCGCAGGTTCGAATCCTGCAGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna22 (2829543-2829618)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2829576-2829578)	Score: 85.17
Seq: TCCTCCTTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCACTGGTTCAAGTCCAGTAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (3894450-3894525)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (3894483-3894485)	Score: 85.17
Seq: TCCTCCTTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCACTGGTTCAAGTCCAGTAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna57 (4268596-4268521)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (4268563-4268561)	Score: 85.17
Seq: TCCTCCTTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCACTGGTTCAAGTCCAGTAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna23 (2829621-2829696)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2829654-2829656)	Score: 85.53
Seq: TCCCTCGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCACAGGTTCAAGTCCTGTCGAGGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (2702867-2702942)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2702900-2702902)	Score: 87.36
Seq: TCCCCCGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCACTGGTTCAAGTCCAGTCGGGGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna12 (355180-355256)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (355214-355216)	Score: 95.34
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (809122-809198)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (809156-809158)	Score: 95.34
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna43 (4697596-4697520)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (4697562-4697560)	Score: 95.34
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna51 (4449246-4449170)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (4449212-4449210)	Score: 95.34
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna100 (3111351-3111278)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (3111319-3111317)	Score: 53.70
Seq: GGCGCGTTAGCAAAGCGGTTATGCAGCGGATTGCAAATCCGTTTAGTCCGGTTCGACTCCGGAACGTGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna96 (3487523-3487450)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (3487491-3487489)	Score: 53.70
Seq: GGCGCGTTAGCAAAGCGGTTATGCAGCGGATTGCAAATCCGTTTAGTCCGGTTCGACTCCGGAACGTGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna29 (3572241-3572315)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (3572273-3572275)	Score: 61.93
Seq: TGGGGCATCGCCAAGCGGTAAGGCAGCGGGTTTTGATCTCGCCATaCCTAGGTTCGAATCCTAGTGCCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (3572592-3572666)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (3572624-3572626)	Score: 61.93
Seq: TGGGGCATCGCCAAGCGGTAAGGCAGCGGGTTTTGATCTCGCCATaCCTAGGTTCGAATCCTAGTGCCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (3572020-3572094)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (3572052-3572054)	Score: 62.85
Seq: TGGGGTATCGCCAAGCGGTAAGGCAGCGGGTTTTGATCTCGCCATcCCTAGGTTCGAATCCTAGTACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna30 (3572357-3572431)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (3572389-3572391)	Score: 62.85
Seq: TGGGGTATCGCCAAGCGGTAAGGCAGCGGGTTTTGATCTCGCCATcCCTAGGTTCGAATCCTAGTACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (3566154-3566228)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (3566186-3566188)	Score: 67.44
Seq: TGGGGTATCGCCAAGCGGTAAGGCAGCGGGTTTTGATCTCGCCATtCCTAGGTTCGAATCCTAGTACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna11 (351690-351765)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (351724-351726)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna13 (805590-805665)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (805624-805626)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (934767-934842)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (934801-934803)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (4701129-4701054)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (4701095-4701093)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (86944-87019)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (86978-86980)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (165116-165191)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (165150-165152)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna79 (3955008-3954933)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (3954974-3954972)	Score: 62.50
Seq: GTCCCCTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna97 (3414662-3414589)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (3414630-3414628)	Score: 74.92
Seq: GCGGGTGTAGTTCAATGGTAGAACGGTAGCTTCCCAAGCTGCATACGTGGGTTCGATTCCCATCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna80 (3882630-3882555)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3882597-3882595)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna81 (3882529-3882454)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3882496-3882494)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna82 (3882420-3882345)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3882387-3882385)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna83 (3882320-3882245)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3882287-3882285)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna84 (3882220-3882145)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3882187-3882185)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna85 (3882120-3882045)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3882087-3882085)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna86 (3882020-3881945)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3881987-3881985)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna95 (3487654-3487579)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3487621-3487619)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna99 (3111461-3111386)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3111428-3111426)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna47 (4476138-4476064)	Length: 75 bp
Type: Gly	Anticodon: TCC at 34-36 (4476105-4476103)	Score: 64.85
Seq: GCGGGCATCGTATAATGGCtATTACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTGCCCGCTCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna98 (3414494-3414420)	Length: 75 bp
Type: Gly	Anticodon: TCC at 34-36 (3414461-3414459)	Score: 64.85
Seq: GCGGGCATCGTATAATGGCtATTACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTGCCCGCTCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna120 (2026913-2026838)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (2026880-2026878)	Score: 80.26
Seq: GTGGCTGTAGCTCAGTTGGTAGAGTCCCGGATTGTGATTCCGGTTGtCGTGGGTTCGAGCCCCATCAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna2 (29373-29448)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (29406-29408)	Score: 80.26
Seq: GTGGCTGTAGCTCAGTTGGTAGAGTCCCGGATTGTGATTCCGGTTGtCGTGGGTTCGAGCCCCATCAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna49 (4452828-4452752)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (4452794-4452792)	Score: 95.89
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGTGGTTCGAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna52 (4369806-4369730)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (4369772-4369770)	Score: 95.89
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGTGGTTCGAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna8 (216523-216599)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (216557-216559)	Score: 95.89
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGTGGTTCGAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna64 (4129749-4129664)	Length: 86 bp
Type: Leu	Anticodon: CAA at 35-37 (4129715-4129713)	Score: 75.64
Seq: GCCCGGGTGGCGAAATCGGTaGACGCAGCGGATTCAAAATCCGCCGGTGAATaACCGTGTCGGTTCGAGTCCGACCCCGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna37 (4234485-4234570)	Length: 86 bp
Type: Leu	Anticodon: CAG at 35-37 (4234519-4234521)	Score: 63.52
Seq: GCGAAGGTGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGTTAGTGTCCCACGGATGTGAGGGTTCGAGTCCCTCTCTTCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<....>>..<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna39 (4234756-4234841)	Length: 86 bp
Type: Leu	Anticodon: CAG at 35-37 (4234790-4234792)	Score: 63.52
Seq: GCGAAGGTGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGTTAGTGTCCCACGGATGTGAGGGTTCGAGTCCCTCTCTTCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<....>>..<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (4235044-4235129)	Length: 86 bp
Type: Leu	Anticodon: CAG at 35-37 (4235078-4235080)	Score: 63.52
Seq: GCGAAGGTGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGTTAGTGTCCCACGGATGTGAGGGTTCGAGTCCCTCTCTTCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<....>>..<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna3 (29469-29554)	Length: 86 bp
Type: Leu	Anticodon: CAG at 35-37 (29503-29505)	Score: 67.52
Seq: GCGAAGGTGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGTTAGTGCCCCCCGGGTGTGAGGGTTCGAGTCCCTCTCTTCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>..<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna38 (4234626-4234711)	Length: 86 bp
Type: Leu	Anticodon: CAG at 35-37 (4234660-4234662)	Score: 67.52
Seq: GCGAAGGTGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGTTAGTGCCCCCCGGGTGTGAGGGTTCGAGTCCCTCTCTTCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>..<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna40 (4234887-4234972)	Length: 86 bp
Type: Leu	Anticodon: CAG at 35-37 (4234921-4234923)	Score: 67.52
Seq: GCGAAGGTGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGTTAGTGCCCCCCGGGTGTGAGGGTTCGAGTCCCTCTCTTCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>..<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna93 (3727685-3727601)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (3727651-3727649)	Score: 61.40
Seq: GCCGTGGTGGTGGAATTGGTaGACACGCTATCTTGAGGGGGTAGTGCTCTAGGGTGTGCGGGTTCGAGTCCCGCCCACGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>><<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna101 (3111236-3111150)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (3111202-3111200)	Score: 75.24
Seq: GCCCGAGTGGTGAAATCGGTaGACACAAGGGATTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (3572788-3572871)	Length: 84 bp
Type: Leu	Anticodon: TAG at 35-37 (3572822-3572824)	Score: 78.55
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCCTAGGCGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>><<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna67 (4069641-4069566)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (4069608-4069606)	Score: 91.87
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTCTTAATCAATTGGtCGTAGGTTCGATCCCTACACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna65 (4069872-4069797)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4069839-4069837)	Score: 96.39
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCTGGTTCGAATCCAGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna69 (4069445-4069370)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4069412-4069410)	Score: 96.39
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCTGGTTCGAATCCAGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna71 (4069254-4069179)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4069221-4069219)	Score: 96.39
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCTGGTTCGAATCCAGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna73 (4069062-4068987)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4069029-4069027)	Score: 96.39
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCTGGTTCGAATCCAGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna75 (4068871-4068796)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4068838-4068836)	Score: 96.39
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCTGGTTCGAATCCAGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna77 (4068680-4068605)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4068647-4068645)	Score: 96.39
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCTGGTTCGAATCCAGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna104 (2640467-2640391)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2640433-2640431)	Score: 81.80
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCAGTTCAAATCTGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna94 (3727508-3727432)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3727474-3727472)	Score: 84.66
Seq: CGCGGGGTGGAGCAGCAtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna105 (2640298-2640222)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2640264-2640262)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna106 (2640125-2640049)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2640091-2640089)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna107 (2639952-2639876)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2639918-2639916)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna108 (2639779-2639703)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2639745-2639743)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna109 (2639606-2639530)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2639572-2639570)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna110 (2639433-2639357)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2639399-2639397)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna111 (2639259-2639183)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2639225-2639223)	Score: 86.71
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna15 (897169-897245)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (897203-897205)	Score: 90.81
Seq: GGCCCCTTAGCTCAGTTGGTcAGAGCAGTCGACTCATAATCGATTGGtCGTGGGTTCAAGTCCCCCAGGGGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr.trna27 (3571935-3572011)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3571969-3571971)	Score: 93.33
Seq: GGCTATGTAGCTCAGTTGGTtAGAGCATCGCACTCATAATGCGGGGGtCACAGGTTCGAATCCCGTCATAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chr.trna31 (3572470-3572546)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3572504-3572506)	Score: 93.33
Seq: GGCTATGTAGCTCAGTTGGTtAGAGCATCGCACTCATAATGCGGGGGtCACAGGTTCGAATCCCGTCATAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chr.trna33 (3572703-3572779)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3572737-3572739)	Score: 93.33
Seq: GGCTATGTAGCTCAGTTGGTtAGAGCATCGCACTCATAATGCGGGGGtCACAGGTTCGAATCCCGTCATAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chr.trna35 (3894370-3894445)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (3894403-3894405)	Score: 89.80
Seq: GCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGtCGGCGGTTCGATTCCGTCTCTGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna54 (4268924-4268849)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (4268891-4268889)	Score: 89.80
Seq: GCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGtCGGCGGTTCGATTCCGTCTCTGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna56 (4268717-4268642)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (4268684-4268682)	Score: 89.80
Seq: GCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGtCGGCGGTTCGATTCCGTCTCTGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (4579934-4579858)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (4579900-4579898)	Score: 89.45
Seq: CGGTGTGTAGCGCAGCTtGGTAGCGCACTTCGTTCGGGACGAAGGGGtCGGAGGTTCGAATCCTCTCACACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (2900868-2900944)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (2900902-2900904)	Score: 74.34
Seq: CGGTGTGTAGCGCAGCCaGGTAGCGCATCTGCATGGGGTGTAGAGGGtCGGAGGTTCGAATCCTCTCACACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (3162154-3162230)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (3162188-3162190)	Score: 74.34
Seq: CGGTGTGTAGCGCAGCCaGGTAGCGCATCTGCATGGGGTGTAGAGGGtCGGAGGTTCGAATCCTCTCACACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna118 (2027152-2027076)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (2027118-2027116)	Score: 86.34
Seq: CGGTGATTAGCGCAGCCcGGTAGCGCATCTGGTTTGGGACCAGAGGGtCAAAGGTTCGAATCCTTTATCACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (29628-29704)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (29662-29664)	Score: 86.34
Seq: CGGTGATTAGCGCAGCCcGGTAGCGCATCTGGTTTGGGACCAGAGGGtCAAAGGTTCGAATCCTTTATCACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna115 (2322902-2322825)	Length: 78 bp
Type: Val	Anticodon: GAC at 34-36 (2322869-2322867)	Score: 31.36
Seq: GGCTTATAGCTCAGTTGGTtAGAACAGTACTTTGACATGGCGTAGGCGAtGtCGTTGGTTCGAATCCAATTGAACACA
Str: >>.>>>..>.>>.........<<.<.>>.>>.......<<.<<..........>>>>>.......<<<<<<<<.<.<.
                    
chr.trna87 (3881881-3881802)	Length: 80 bp
Type: Gly	Anticodon: GCC at 38-40 (3881844-3881842)	Score: 30.09
Seq: GCTGCCATATTCAGTTGGTAGAGCAtgatcCGCGCTTGCCAAGGCTGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>.>..>..>>>........<<<.......>>..>.......<..<<.....>>>>>.......<<<<<<..<.<<....
                    
chr.trna21 (2791529-2791616)	Length: 88 bp
Type: SeC(p)	Anticodon: TCA at 35-37 (2791563-2791565)	Score: 32.53
Seq: GGAAGCTGATGGGGTCTGGTGGCCTCCTCGGTCTTCAAAACCGATGAGAGCCGAGAAGGCTTTGGCAGGTTCGATTCCTGCCTCTTCC
Str: >>>>>.....>>>>>>....<<<<<<.>>>>>.......<<<<<.>>>..>......<..<<<.>>>>>.......<<<<<..<<<<<
                    
chr.trna18 (1432952-1433041)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (1432986-1432988)	Score: 68.59
Seq: GGAGAGATGCCGGAGTGGCcgAACGGGATTGACTCGAAATCAATTGTGGCAGCAATGCCACCCAGGGTTCGAATCCCTGTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna58 (4142268-4142176)	Length: 93 bp
Type: Ser	Anticodon: GCT at 35-37 (4142234-4142232)	Score: 71.74
Seq: GGAGAGGTGGCCGAGAGGCtgAAGGCGCTCCCCTGCTAAGGGAGTATGCGGCTTATaCCCGCATCGGGGGTTCGAATCCCCCCTTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>.......<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna103 (2827066-2826979)	Length: 88 bp
Type: Ser	Anticodon: GGA at 35-37 (2827032-2827030)	Score: 68.20
Seq: GGTGAGGTGTCCGAGTGGCtgAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGAGGGTTCGAATCCCTCCCTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna121 (1955555-1955468)	Length: 88 bp
Type: Ser	Anticodon: GGA at 35-37 (1955521-1955519)	Score: 68.20
Seq: GGTGAGGTGTCCGAGTGGCtgAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGAGGGTTCGAATCCCTCCCTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna19 (1989214-1989301)	Length: 88 bp
Type: Ser	Anticodon: GGA at 35-37 (1989248-1989250)	Score: 68.20
Seq: GGTGAGGTGTCCGAGTGGCtgAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGAGGGTTCGAATCCCTCCCTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna102 (2983787-2983700)	Length: 88 bp
Type: Ser	Anticodon: TGA at 35-37 (2983753-2983751)	Score: 68.13
Seq: GGAGGGGTGGCAGAGCGGCtgAATGCACCGGTCTTGAAAACCGGCGATGGGCGACCATCCGTGGGTTCAAATCCCACCTCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>.><.<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1210105-1210192)	Length: 88 bp
Type: Ser	Anticodon: TGA at 35-37 (1210139-1210141)	Score: 68.13
Seq: GGAGGGGTGGCAGAGCGGCtgAATGCACCGGTCTTGAAAACCGGCGATGGGCGACCATCCGTGGGTTCAAATCCCACCTCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>.><.<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna124 (1458020-1457945)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (1457987-1457985)	Score: 90.80
Seq: GCCGGTATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGtCGGGGGTTCGACTCCTCTTACCGGCACCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna10 (220152-220227)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (220185-220187)	Score: 89.28
Seq: GCTGATATGGCTCAGTTGGTAGAGCGCATCCTTGGTAAGGATGAGGtCCCCAGTTCGACTCTGGGTATCAGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna6 (90487-90562)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (90520-90522)	Score: 89.28
Seq: GCTGATATGGCTCAGTTGGTAGAGCGCATCCTTGGTAAGGATGAGGtCCCCAGTTCGACTCTGGGTATCAGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna55 (4268796-4268721)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (4268763-4268761)	Score: 92.56
Seq: GCCGGCTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGtCACCAGTTCGATTCCGGTAGCCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
chr.trna45 (4526386-4526310)	Length: 77 bp
Type: Trp	Anticodon: CCA at 35-37 (4526352-4526350)	Score: 74.57
Seq: AGGGGCGTAGTTCcAATTGGTAGAACAGCGGTCTCCAAAACCGATGGtTGCGGGTTCGAGTCCTGCCGCCCCTGCCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna48 (4474654-4474578)	Length: 77 bp
Type: Trp	Anticodon: CCA at 35-37 (4474620-4474618)	Score: 74.57
Seq: AGGGGCGTAGTTCgAATTGGTAGAACAGCGGTCTCCAAAACCGATGGtTGCGGGTTCGAGTCCTGCCGCCCCTGCCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna123 (1702522-1702438)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1702488-1702486)	Score: 66.59
Seq: GGAGGGGTTCCCGAGCGGCcaAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna126 (1108548-1108464)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1108514-1108512)	Score: 66.59
Seq: GGAGGGGTTCCCGAGCGGCcaAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna127 (1108432-1108348)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1108398-1108396)	Score: 66.59
Seq: GGAGGGGTTCCCGAGCGGCcaAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna128 (1108316-1108232)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1108282-1108280)	Score: 66.59
Seq: GGAGGGGTTCCCGAGCGGCcaAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (4476261-4476177)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (4476227-4476225)	Score: 66.59
Seq: GGAGGGGTTCCCGAGCGGCcaAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna122 (1702658-1702574)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1702624-1702622)	Score: 67.45
Seq: GGAGGGGTTCCCGAGTGGCcaAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna114 (2323017-2322941)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2322983-2322981)	Score: 90.51
Seq: GCGTCCTTAGCTCAGCTGGTtAGAGCATCACCTTGACATGGTGGGGGtCGGTGGTTCGAATCCACTAGGACGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna117 (2322705-2322629)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2322671-2322669)	Score: 90.51
Seq: GCGTCCTTAGCTCAGCTGGTtAGAGCATCACCTTGACATGGTGGGGGtCGGTGGTTCGAATCCACTAGGACGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna112 (2323200-2323124)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2323166-2323164)	Score: 91.82
Seq: GGGTTTATAGCTCAGTTGGTtAGAGCACTACCTTGACATGGTAGGGGtCGTTGGTTCGAATCCAATTAAACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna116 (2322819-2322743)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2322785-2322783)	Score: 91.82
Seq: GGGTTTATAGCTCAGTTGGTtAGAGCACTACCTTGACATGGTAGGGGtCGTTGGTTCGAATCCAATTAAACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna113 (2323111-2323035)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2323077-2323075)	Score: 95.18
Seq: GCGTCCTTAGCTCAGCTGGTtAGAGCACCACCTTGACATGGTGGGGGtCGGTGGTTCGAATCCACTAGGACGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna66 (4069765-4069690)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4069732-4069730)	Score: 93.75
Seq: GGTCGCTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGATCCCAGTAGCGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna70 (4069352-4069277)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4069319-4069317)	Score: 93.87
Seq: GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGATCCCAGTAACGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna72 (4069162-4069087)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4069129-4069127)	Score: 93.87
Seq: GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGATCCCAGTAACGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna74 (4068970-4068895)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4068937-4068935)	Score: 93.87
Seq: GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGATCCCAGTAACGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna76 (4068778-4068703)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4068745-4068743)	Score: 93.87
Seq: GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGATCCCAGTAACGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna78 (4068587-4068512)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4068554-4068552)	Score: 93.87
Seq: GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGATCCCAGTAACGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna68 (4069544-4069469)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (4069511-4069509)	Score: 94.81
Seq: GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGAGCCCAGTAACGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.