GtRNAdb

tRNAscan-SE Analysis of Burkholderia pseudomallei 668

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chrI.trna18 (3722177-3722102)	Length: 76 bp
Type: Ala	Anticodon: CGC at 34-36 (3722144-3722142)	Score: 84.28
Seq: GGGGCGGTAGCTCAGCTGGGAGAGCGTCGCGTTCGCAATGCGAAGGtCGGGAGTTCGATCCTCCTCCGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna34 (2447940-2447865)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (2447907-2447905)	Score: 86.46
Seq: GGGGGTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCAGCGGTTCGATCCCGCTTACCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna20 (3683638-3683563)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (3683605-3683603)	Score: 90.89
Seq: GGGGGCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGCCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chrI.trna27 (3476255-3476180)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (3476222-3476220)	Score: 90.89
Seq: GGGGGCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGCCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chrI.trna4 (1297262-1297337)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (1297295-1297297)	Score: 90.89
Seq: GGGGGCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGCCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chrII.trna2 (560084-560159)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (560117-560119)	Score: 90.89
Seq: GGGGGCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGCCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chrI.trna11 (2900832-2900908)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2900866-2900868)	Score: 87.10
Seq: GCGGCTGTAGCTCAGTTGGAtAGAGTACTTGGCTACGAACCAAGGGGtCGTGGGTTCGAATCCTGCCAGCCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna12 (2900968-2901044)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2901002-2901004)	Score: 87.10
Seq: GCGGCTGTAGCTCAGTTGGAtAGAGTACTTGGCTACGAACCAAGGGGtCGTGGGTTCGAATCCTGCCAGCCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna17 (3814265-3814190)	Length: 76 bp
Type: Arg	Anticodon: CCG at 34-36 (3814232-3814230)	Score: 82.41
Seq: GCGCCCGTAGCTCAATGGAtAGAGTACTGCCCTCCGAAGGCAGGGGtTGCTGGTTCGATCCCAGCCGGGCGCGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna48 (1104955-1104881)	Length: 75 bp
Type: Arg	Anticodon: CCT at 34-36 (1104922-1104920)	Score: 72.32
Seq: CTCCCCGTAGTTCAATGGAtAGAACAAGCGCCTCCTAAGCGCTAGATACAGGTTCGATTCCTGTCGGGGGGACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna5 (1476780-1476856)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (1476814-1476816)	Score: 86.86
Seq: CCGCCCTTAGCTCAGTCGGAtAGAGCAACGGCCTTCTAAGCCGTAGGtCACACGTTCGAATCGTGTAGGGCGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna8 (2780465-2780540)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2780498-2780500)	Score: 85.87
Seq: TCCCCGATAGCTCAGTCGGTAGAGCGCCGGACTGTTAATCCGTAGGtCCCTGGTTCGAGCCCAGGTCGGGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna9 (2780630-2780705)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2780663-2780665)	Score: 85.87
Seq: TCCCCGATAGCTCAGTCGGTAGAGCGCCGGACTGTTAATCCGTAGGtCCCTGGTTCGAGCCCAGGTCGGGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna41 (2295600-2295524)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2295566-2295564)	Score: 90.54
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGgCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna36 (2447561-2447485)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2447527-2447525)	Score: 95.34
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna38 (2447263-2447187)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2447229-2447227)	Score: 95.34
Seq: GGAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna4 (1371358-1371431)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1371390-1371392)	Score: 56.83
Seq: GGCGCGGTAGCAAAGCGGTTATGCGGCGGCCTGCAAAGCCGCTCAGGTCGGTTCGACTCCGGCTCGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna31 (2733197-2733124)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (2733165-2733163)	Score: 64.85
Seq: GGCGCGATAGCAAAGCGGTTATGCAGCGGCCTGCAAAGCCGTGTAGGCCGGTTCGACTCCGGCTCGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna51 (540639-540563)	Length: 77 bp
Type: Gln	Anticodon: TTG at 35-37 (540605-540603)	Score: 75.81
Seq: AGGGGAGTCGCCAAGTTGGTtAAGGCACCGGATTTTGATTCCGGCATgCGAGGGTTCGAGTCCTTCCTCCCCTGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna35 (2447714-2447639)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2447680-2447678)	Score: 60.10
Seq: GTCCCCTTCGTCTAGAGGCctAGGACATCACCCTTTCACGGTGAGTACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna37 (2447420-2447345)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2447386-2447384)	Score: 60.10
Seq: GTCCCCTTCGTCTAGAGGCctAGGACATCACCCTTTCACGGTGAGTACAGGGGTTCGAATCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna14 (3000645-3000719)	Length: 75 bp
Type: Gly	Anticodon: CCC at 34-36 (3000678-3000680)	Score: 61.13
Seq: GCGGGCGTCGTATAATGGCcATTACCTCAGCTTCCCAAGCTGATGACGTGGGTTCGATTCCCATCGCCCGCTCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna29 (2733522-2733447)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (2733489-2733487)	Score: 89.05
Seq: GCGGGAGTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCGCGAGTTCGAGACTCGTCTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna30 (2733387-2733312)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (2733354-2733352)	Score: 89.05
Seq: GCGGGAGTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCGCGAGTTCGAGACTCGTCTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna22 (3679095-3679022)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (3679063-3679061)	Score: 82.17
Seq: GCGGGTGTAGCTCAATGGTAGAGCAGAAGCCTTCCAAGCTTACGACGAGGGTTCGATTCCCTTCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna42 (1794441-1794366)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (1794408-1794406)	Score: 80.89
Seq: GTGGCTGTAGCTCAGTTGGTAGAGTCCAGGATTGTGATTCCTGTTGtCGTGGGTTCGAGTCCCATCAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna19 (3683749-3683673)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (3683715-3683713)	Score: 93.29
Seq: GGGTCTGTAGCTCAGTCGGTtAGAGCACCGTCTTGATAAGGCGGGGGtCGTTGGTTCGAATCCAACCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna26 (3476366-3476290)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (3476332-3476330)	Score: 93.29
Seq: GGGTCTGTAGCTCAGTCGGTtAGAGCACCGTCTTGATAAGGCGGGGGtCGTTGGTTCGAATCCAACCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna3 (1297151-1297227)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (1297185-1297187)	Score: 93.29
Seq: GGGTCTGTAGCTCAGTCGGTtAGAGCACCGTCTTGATAAGGCGGGGGtCGTTGGTTCGAATCCAACCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna1 (559973-560049)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (560007-560009)	Score: 93.29
Seq: GGGTCTGTAGCTCAGTCGGTtAGAGCACCGTCTTGATAAGGCGGGGGtCGTTGGTTCGAATCCAACCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna49 (979220-979136)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (979186-979184)	Score: 75.09
Seq: GCCCAGGTGGTGAAATTGGTaGACGCAGGGGACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna44 (1772301-1772215)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (1772267-1772265)	Score: 70.94
Seq: GCCCAGGTGGCGAAATTGGTaGACGCACTAGGTTCAGGTCCTAGCGGTGGCAACACCGTGGAGGTTCGAGTCCTCTCTTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna45 (1772057-1771971)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (1772023-1772021)	Score: 76.78
Seq: GCCCAGGTGGCGGAATTGGTaGACGCACTAGGTTCAGGTCCTAGCGGTGGCAACACCGTGGAGGTTCGAGTCCTCTCCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna2 (1260303-1260387)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (1260337-1260339)	Score: 63.68
Seq: GCCGACGTGGTGAAATTGGTaGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCGAGTTCGAGTCTCGCCGTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna7 (1094024-1093940)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (1093990-1093988)	Score: 65.46
Seq: GCCGACGTGGTGAAATTGGTaGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCCGTGCGAGTTCGAGTCTCGCCGTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna39 (2321899-2321813)	Length: 87 bp
Type: Leu	Anticodon: TAG at 35-37 (2321865-2321863)	Score: 77.10
Seq: GCGTGAGTGGCGAAATTGGTaGACGCACCAGGTTTAGGTCCTGACGCCCGCAAGGGCGTGCCGGTTCGAGTCCGGCCTCACGCACCA
Str: >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna52 (135067-134992)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (135034-135032)	Score: 94.68
Seq: GGGGCGTTAGCTCAGTTGGTAGAGCAGCGGACTCTTAATCCGTAGGtCGAGTGTTCGAGTCACTCACGCCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna15 (3138934-3139009)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (3138967-3138969)	Score: 92.38
Seq: GGGTCGTTAGCTCAGCTGGTAGAGCAGCGGACTTTTAATCCGTTGGtCACTGGTTCGAATCCAGTACGGCCTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna32 (2593639-2593563)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2593605-2593603)	Score: 86.01
Seq: CGCGGGGTGGAGCAGTCtGGCAGCTCGTCGGGCTCATAACCCGAAGGtCGTAGGTTCAAATCCTACCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna43 (1786078-1786002)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1786044-1786042)	Score: 86.01
Seq: CGCGGGGTGGAGCAGTCtGGCAGCTCGTCGGGCTCATAACCCGAAGGtCGTAGGTTCAAATCCTACCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrII.trna6 (2436604-2436529)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (2436571-2436569)	Score: 86.24
Seq: GGGCCTGTAGCTCAGGGGTtAGAGCAGTCGACTCATAATCGATTGGtCGCGGGTTCGAAACCCGCCGGGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna50 (786276-786200)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (786242-786240)	Score: 88.36
Seq: GGCGAATTAGCTCAGTCGGTtAGAGCGACGGAATCATAATCCGCAGGtCCGGGGTTCGAGTCCCTGATTCGCCACCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna1 (152929-153004)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (152962-152964)	Score: 87.37
Seq: GGCCCGGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGtCGGTGGTTCGATTCCGCCCCAGGCCACCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<....
                    
chrI.trna16 (3414437-3414513)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (3414471-3414473)	Score: 81.43
Seq: CGGGGTGTAGCTTAGCCtGGTAGAGCGCTACGTTCGGGACGTAGAGGcCGGAGGTTCGAATCCTCTCACCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna46 (1697754-1697678)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (1697720-1697718)	Score: 81.38
Seq: CGGGGCGTAGCGCAGCCtGGTAGCGTACCTGCATGGGGTGCAGGTGGtCGGAGGTTCAAATCCTCTCGCCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna47 (1466575-1466499)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (1466541-1466539)	Score: 88.66
Seq: CGGAGCGTAGCGCAGCCtGGTAGCGCATCTGATTTGGGATCAGAGGGtCGTAGGTTCGAATCCTATCGCTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna28 (2930601-2930511)	Length: 91 bp
Type: Ser	Anticodon: CGA at 35-37 (2930567-2930565)	Score: 69.83
Seq: GGAAAGGTGGCAGAGAGGTcgAATGCGCCGGACTCGAAATCCGGTATACGGTTATaCCGTATCGTGGGTTCGAATCCCACCCTTTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>.....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna33 (2511295-2511202)	Length: 94 bp
Type: Ser	Anticodon: GCT at 35-37 (2511261-2511259)	Score: 69.97
Seq: GGAGACGTGGCCGAGAGGTcgAAGGCACTCCCCTGCTAAGGGAGCATCTGGGCCAAaACCTGGAtCGAGGGTTCGAATCCCTCCGTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>.>>.......<<.<<...>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna3 (591973-592062)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (592007-592009)	Score: 75.69
Seq: GGAGAGATGGATGAGTGGTttAAGTCGCACGCCTGGAAAGCGTGTATAGGTGAAAGCCTATCGGGGGTTCGAATCCCCCTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna13 (2908425-2908512)	Length: 88 bp
Type: Ser	Anticodon: TGA at 35-37 (2908459-2908461)	Score: 78.34
Seq: GGAAGCGTGGCCGAGTGGTttAAGGCACTGGTCTTGAAAACCAGCGACGGGCAACCGTCCGTGAGTTCGAATCTCACCGCTTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna10 (2887205-2887280)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (2887238-2887240)	Score: 88.22
Seq: GCCGGTGTAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGtCGGAAGTTCGAGTCTTCTCTCCGGCACCA
Str: >>>>>.>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<.<<<<<....
                    
chrI.trna23 (3678997-3678923)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (3678965-3678963)	Score: 90.12
Seq: GCCCATGTGGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGtCGGCAGTTCGATCCTGCCCATGGGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna25 (3574046-3573971)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (3574013-3574011)	Score: 81.30
Seq: GCCGGCTTAGCTCATCTGGTAGAGCAGTTGATTTGTAATCATCAGGtGGCGGGTTCGAGTCCTGCAGCCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna24 (3677610-3677535)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (3677577-3677575)	Score: 84.85
Seq: AGGGGTATAGCTCAACTGGCAGAGCGTCGGTCTCCAAAACCGAAGGtTGGGGGTTCGATTCCCTCTGCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna21 (3679224-3679139)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 35-37 (3679190-3679188)	Score: 66.50
Seq: GGAGGGGTGCCCGAGTGGCtaAAGGGGGCAGACTGTAAATCTGTTGGCTTACGCCTaCGTTGGTTCGAATCCAACCTCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna7 (2629298-2629372)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (2629330-2629332)	Score: 91.15
Seq: GGGCGGTTAGCTCAGCGGTAGAGCACTGCCTTCACACGGCAGGGGtCACTGGTTCGATCCCAGTACCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna6 (1685116-1685192)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (1685150-1685152)	Score: 91.08
Seq: AGGCTCGTAGCTCAGTTGGTtAGAGCACCACCTTGACATGGTGGGGGtCGTTGGTTCGAATCCAATCGAGCCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna5 (2760092-2760016)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2760058-2760056)	Score: 91.08
Seq: AGGCTCGTAGCTCAGTTGGTtAGAGCACCACCTTGACATGGTGGGGGtCGTTGGTTCGAATCCAATCGAGCCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna40 (2299192-2299117)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (2299159-2299157)	Score: 93.03
Seq: GGGTGCTTAGCTCAGTTGGTAGAGCGGCGCCCTTACAAGGCGTAGGtCGGGAGTTCGAGCCTCTCAGCACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.