GtRNAdb

tRNAscan-SE Analysis of Caldicellulosiruptor saccharolyticus DSM 8903

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna1 (285859-285934)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (285892-285894)	Score: 97.84
Seq: GGGGATGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGtCAGGAGTTCGAATCTCCTCATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna29 (2378529-2378454)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (2378496-2378494)	Score: 97.84
Seq: GGGGATGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGtCAGGAGTTCGAATCTCCTCATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna21 (2884554-2884630)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2884588-2884590)	Score: 85.25
Seq: GCGCCCATAGCTCAATTGGAtAGAGCATCAGACTACGGATCTGAGGGtTGGGGGTTCGAGTCCTCCTGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (1617941-1617865)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (1617907-1617905)	Score: 83.91
Seq: GCGCCCGTAGCTCAGCAGGAtAGAGCAATGGTTTCCTAAACCATGTGcCGGAGGTTCGAGTCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (1143797-1143722)	Length: 76 bp
Type: Arg	Anticodon: TCG at 34-36 (1143764-1143762)	Score: 83.33
Seq: GCGCCCGTAGCTCAGAGGAtAGAGCGTAGGACTTCGAATCCTGTGGtCGGGGGTTCGAGTCCCCCCGGGCGTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna8 (605848-605924)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (605882-605884)	Score: 90.40
Seq: GCGCCCATAGCTCAGCTGGAtAGAGCAACGGACTTCTAATCCGTTGGcCGGGGGTTCGAATCCTCCTGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna23 (2876718-2876644)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (2876686-2876684)	Score: 85.92
Seq: TCCTCGGTAGCTCAGCGGTGGAGCATCCGGCTGTTAACCGGAGGGtCGTAGGTTCGAATCCTACCCGGGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna11 (1020512-1020588)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (1020546-1020548)	Score: 94.23
Seq: GGCCCAGTAGCTCAGTCGGTtAGAGCGCCAGCCTGTCACGCTGGAGGtCGAGGGTTCAAGTCCCTTCTGGGTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (1020792-1020866)	Length: 75 bp
Type: Cys	Anticodon: GCA at 33-35 (1020824-1020826)	Score: 75.30
Seq: GGCGCCATAGCCAAGCGGTAAGGCAAGGGTCTGCAAAATCCTGATtCCCCGGTTCAAATCCGGGTGGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna27 (2390246-2390173)	Length: 74 bp
Type: Gln	Anticodon: CTG at 33-35 (2390214-2390212)	Score: 67.06
Seq: TGCGGGATGGTGTAATGGTAGCACAGGTGACTCTGGATCACCTTGTCTAGGTTCGAGTCCTAGTCCCGCAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (1400565-1400640)	Length: 76 bp
Type: Gln	Anticodon: TTG at 33-35 (1400597-1400599)	Score: 70.79
Seq: TGGGGTGTCGCCAAGCGGTAAGGCACAGGACTTTGACTCCTGCATTCCGGTGGTTCGAATCCACCCACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (2390168-2390093)	Length: 76 bp
Type: Glu	Anticodon: CTC at 35-37 (2390134-2390132)	Score: 66.66
Seq: GGCCCTATCGTCTAGAGGCctAGGACACCGCCCTCTCACGGCGGAGACAGGGGTTCGAATCCCCTTAGGGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (2742649-2742575)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2742616-2742614)	Score: 78.95
Seq: GGCCCCGTGGTCAAGTGGTtAAGACACAGGCCTTTCACGCCTGTAACAGGGGTTCGAATCCCCTCGGGGTCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna38 (2323939-2323865)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2323906-2323904)	Score: 78.95
Seq: GGCCCCGTGGTCAAGTGGTtAAGACACAGGCCTTTCACGCCTGTAACAGGGGTTCGAATCCCCTCGGGGTCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (2350859-2350786)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (2350827-2350825)	Score: 86.50
Seq: GCGGGTGTAGTTCAATGGTAGAACACCAGCTTCCCAAGCTGGTAGCGTGGGTTCGATTCCCATCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna13 (1020694-1020769)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1020727-1020729)	Score: 91.60
Seq: GCGGGAATAGCTCAGGTGGTAGAGCGCTACCTTGCCAAGGTAGATGtCGCGGGTTCGAGTCCCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna18 (1813559-1813632)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (1813591-1813593)	Score: 88.11
Seq: GCGGGTGTAGTTCAATGGTAGAACACCAGCCTTCCAAGCTGGTAGCGTGGGTTCGATTCCCATCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna15 (1400474-1400550)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (1400508-1400510)	Score: 89.65
Seq: GTGGATATAGCTCAGTTGGTtAGAGCGCCAGGTTGTGGCCCTGGAGGtCATGGGTTCGAGTCCCATTATCCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna2 (285944-286020)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (285978-285980)	Score: 94.29
Seq: GGGCTTATAGCTCAGGTGGTtAGAGCGTACGCCTGATAAGCGTAAGGtCGGTGGTTCGAGTCCACCTAAGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna30 (2378447-2378371)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (2378413-2378411)	Score: 94.29
Seq: GGGCTTATAGCTCAGGTGGTtAGAGCGTACGCCTGATAAGCGTAAGGtCGGTGGTTCGAGTCCACCTAAGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna3 (517256-517343)	Length: 88 bp
Type: Leu	Anticodon: CAA at 35-37 (517290-517292)	Score: 72.53
Seq: GCCGAAGTGGTGGAACTGGCaGACGCGCTGGACTCAAAATCCAGTGGCCGCTGaGGCCGTGCGGGTTCGACTCCCGCCTTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>.....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna39 (2318743-2318657)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (2318709-2318707)	Score: 72.00
Seq: GCGGATGTGGCGGAACTGGCaGACGCGCAAGACTCAGGATCTTGTGGGGCTCTCCCCATGGGGGTTCAAATCCCCCCATCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (2884397-2884484)	Length: 88 bp
Type: Leu	Anticodon: GAG at 35-37 (2884431-2884433)	Score: 60.61
Seq: GCCGAGATGGTGGAATTGGCaGACACGCTACTTTGAGGGGGTAGTGGGCGTTATGCCCGTGCGAGTTCGAGTCTCGCTCTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>...<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna35 (2324236-2324147)	Length: 90 bp
Type: Leu	Anticodon: TAA at 35-37 (2324202-2324200)	Score: 74.71
Seq: GCCGGAGTGGCGGAACTGGCaGACGCACAGGACTTAAAATCCTGGGACCTGAATaAGGTCGTACCGGTTCAAGTCCGGTTTCCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>.....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (2324377-2324293)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (2324343-2324341)	Score: 77.00
Seq: GCGGGTATGGCGGAATTGGCaGACGCGCTAGACTTAGGATCTAGTGGCAACAGCCGTGGGGGTTCAAGTCCCTCTACCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (605764-605839)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (605797-605799)	Score: 95.64
Seq: GCGCCATTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGtCTGGGGTTCGAGTCCCTAATGGCGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1405841-1405916)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (1405874-1405876)	Score: 85.02
Seq: GGGCCATTAGCTCAGTAGGCAGAGCACCAGCCTTTTAAGCTGGGTGtCCCGCGTTCGAGTCGCGGATGGCTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (2742748-2742673)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (2742715-2742713)	Score: 85.02
Seq: GGGCCATTAGCTCAGTAGGCAGAGCACCAGCCTTTTAAGCTGGGTGtCCCGCGTTCGAGTCGCGGATGGCTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (2876634-2876559)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (2876601-2876599)	Score: 90.70
Seq: GGGCCTTTAGCTCAGCTGGTAGAGCGGCCGGCTCATAACCGGTTGGtCTGGGGTTCGAATCCCTAAGGGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (2324141-2324066)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (2324108-2324106)	Score: 91.01
Seq: CGCGGGGTGGAGCAGCTGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGGAGGTTCAAATCCTCCCCCCGCAACCA
Str: .>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna37 (2324045-2323969)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2324011-2324009)	Score: 92.07
Seq: GGCGGCGTAGCTCAGTTGGCtAGAGCATGCGGTTCATACCCGCAGTGtCAGCGGTTCGAATCCGTTCGCCGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna12 (1020600-1020675)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (1020633-1020635)	Score: 90.94
Seq: GCCTCGGTAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGtCGGTGGTTCGATTCCGCCCCGAGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna45 (1013667-1013590)	Length: 78 bp
Type: Pro	Anticodon: CGG at 36-38 (1013632-1013630)	Score: 93.10
Seq: CGGGATGTGGCTCAGTTtGGCtAGAGCGCCTGGTTCGGGACCAGGAGGtCGCAGGTTCAAGTCCTGTCATCCCGACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (1891325-1891247)	Length: 79 bp
Type: Pro	Anticodon: GGG at 36-38 (1891290-1891288)	Score: 86.76
Seq: CGGGGCGTAGCTCAGTTtGGTtAGAGCGCTAGCTTGGGGTGCTAGAGGttCGCTGGTTCAAGTCCAGTCGCCCCGACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (605388-605464)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (605422-605424)	Score: 86.25
Seq: CGGGGTGTAGCTCAGCTtGGTAGAGCACGTGGTTTGGGACCATGGGGcCGGAGGTTCAAGTCCTCTCACCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna43 (1389269-1389177)	Length: 93 bp
Type: Ser	Anticodon: CGA at 35-37 (1389235-1389233)	Score: 76.17
Seq: GGAGAGATGGCCGAGTGGTcgAAGGCACGCGACTCGAAATCGCGCGTACCGCCAAAaGCGGTACCGTGGGTTCGAATCCCACTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>>.....<<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (861334-861425)	Length: 92 bp
Type: Ser	Anticodon: GCT at 34-36 (861367-861369)	Score: 77.25
Seq: GGAGAAGTACTCAAGTGGTgAAGAGGCGCCCCTGCTAAGGGCGTAGGTCGGGTAAaACCGGCGCGAGGGTTCGAGTCCCTCCTTCTCCGCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<...>>>>>......<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (330824-330732)	Length: 93 bp
Type: Ser	Anticodon: GGA at 35-37 (330790-330788)	Score: 74.60
Seq: GGAGAGATGGCCGAGTGGTcgAAGGCGCACGACTGGAAATCGTGTGTACCCCCAAAaGGGGTACCGTGGGTTCAAATCCCACTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>>.....<<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna31 (2353899-2353809)	Length: 91 bp
Type: Ser	Anticodon: TGA at 35-37 (2353865-2353863)	Score: 76.00
Seq: GGAAGGGTGTCCGAGTGGTttAAGGAGCTGGTCTTGAAAACCAGTGACCCGCTTACGCGGGCCGTGGGTTCGAATCCCACCCCTTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna19 (2241920-2241994)	Length: 75 bp
Type: Thr	Anticodon: CGT at 33-35 (2241952-2241954)	Score: 91.34
Seq: GCTCCATTAGCTCAGTGGTAGAGCAGTCGATTCGTAATCGACTGGtCGGGGGTTCGAATCCCCCATGGAGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna33 (2350736-2350660)	Length: 77 bp
Type: Thr	Anticodon: GGT at 35-37 (2350702-2350700)	Score: 87.20
Seq: GCCCACGTAGCTCAGTAGGTcAGAGCGTCACCTTGGTAAGGTGGAGGtCACCGGTTCGATTCCGGTCGTGGGCTCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna6 (605662-605737)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (605695-605697)	Score: 87.14
Seq: GCTGGCGTAGCTCAATCGGTAGAGCAGCCGACTTGTAATCGGCAGGtTGCGGGTTCGAGTCCCATCGCCAGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr.trna22 (2938708-2938783)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (2938741-2938743)	Score: 80.49
Seq: AGGGGCGTAGCTCAATTGGTAGAGTAGCGGTCTCCAAAACCGTTGGcTGGGGGTTCGAGTCCCTCCGCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (605560-605644)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (605594-605596)	Score: 76.03
Seq: GGAGGGGTACCCAAGTGGTcaAAGGGGGCAGACTGTAAATCTGTTGCCGCAGGCTtCGTTGGTTCGAATCCAACCCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna40 (1912776-1912700)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (1912742-1912740)	Score: 99.28
Seq: GGGGATATAGCTCAGTTGGTtAGAGCGCTTGCTTGACATGCAAGAGGtCATAGGTTCGAGTCCTATTATCCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna10 (1020428-1020503)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (1020461-1020463)	Score: 96.51
Seq: GGGCGGTTAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCGCAGGTTCGAGCCCTGCACTGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.