GtRNAdb

tRNAscan-SE Analysis of Candidatus Carsonella ruddii PV

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna8 (52958-53029)	Length: 72 bp
Type: Ala	Anticodon: TGC at 34-36 (52991-52993)	Score: 51.38
Seq: GGGGTTATAATTTAATTGGTAAAATATTTGGTTTGCAACCAAAAAAAAAGAGTTCAATTCTCTTTAACTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna25 (98940-98868)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (98907-98905)	Score: 42.08
Seq: ACATTTGTAACTCATCGGAtAGAGTGTTTGATTACGAATCAGATTGtAAAAGGTTCAATTCCTTTCAAATGTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna14 (65237-65310)	Length: 74 bp
Type: Arg	Anticodon: TCT at 35-37 (65271-65273)	Score: 58.32
Seq: GCGTTTATAGCTCAAATGGAtAGAGCAGTGACCTTCTAAGTCAAAGGtTGTAAGTTCAATTCTTACTAAGCGTA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr.trna5 (37565-37637)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (37598-37600)	Score: 72.25
Seq: TCCTTGGTAGCTCAGCTGGTAGAGCAAATGACTGTTAATCATTTGGtCACAGGTTCAATCCCTGTCTAAGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna7 (48296-48369)	Length: 74 bp
Type: Asp	Anticodon: GTC at 35-37 (48330-48332)	Score: 57.70
Seq: GGAGCGATAATTTAGTAGGTtAAAATGTTGGCTTGTCACGTCAAATAtCGCGGGTTCGATTCCCGTTCGTTCCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna10 (53227-53298)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (53259-53261)	Score: 61.05
Seq: TGAGATATAGCCAAGTGGTAAGGTATTGGTTTTTGATACCAAATAtCCTAGGTTCGATTCCTAGTATCTCAG
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna2 (35392-35462)	Length: 71 bp
Type: Glu	Anticodon: TTC at 33-35 (35424-35426)	Score: 33.56
Seq: GTCTTGTTCGTCTAATGGTAGGACCTCGCTCTTTCACGGCGGAAAAAAGGGTTCGAATCCCTTACGAGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna3 (35463-35534)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (35495-35497)	Score: 54.80
Seq: GCGAAAGTATCTTAATGGTAAAGTATCACCTTGCCATGGTGAAAGtTGCGAGTTCGAATCTCGTCTATCGCT
Str: >>>>.>>...>>>.......<<<..>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr.trna22 (147094-147024)	Length: 71 bp
Type: Gly	Anticodon: TCC at 33-35 (147062-147060)	Score: 41.75
Seq: GCGAAAATAGTTTATTGGTAAAATATTATCTTTCCAAGTTATTGtAAAGGGTTCGATTCCCTTTTTTCGCT
Str: >>>>>>>..>>>>.......<<<<..>>.>.......<.<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna15 (65313-65385)	Length: 73 bp
Type: His	Anticodon: GTG at 34-36 (65346-65348)	Score: 69.11
Seq: GTAAATATAGCTCAGCTGGCAGAGCAATAGTTTGTGATACTATTGGtCGCGGGTTCAAATCCCGTTGTTTACC
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna1 (14011-14084)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (14045-14047)	Score: 72.36
Seq: GGGATTGTAGCTCAGTTGGTtAGAGCATACCTCTGATAATGGTAAGGtCAATAGTTCAAATCTATTTAATCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna12 (61144-61216)	Length: 73 bp
Type: Leu	Anticodon: GAG at 34-36 (61177-61179)	Score: 50.51
Seq: ACCGAAATGGTGAAATGGTaAACACTCTATTTTGAGGTAGTAGATTtTACGGGTTCAAATCCCGTTTTCGGTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna19 (96280-96361)	Length: 82 bp
Type: Leu	Anticodon: TAA at 34-36 (96313-96315)	Score: 53.73
Seq: GCCCATATGGCGAAATGGTaGACGCAAAGGACTTAAAATCCTTGGTTTTCTAAACGTGTCAGTTCAAATCTGACTTTGGGTA
Str: >>>>>.>..>>>..........<<<.>>>>>.......<<<<<...>>>..<<<...>>>>>.......<<<<<<.<<<<<.
                    
chr.trna26 (97213-97140)	Length: 74 bp
Type: Lys	Anticodon: TTT at 35-37 (97179-97177)	Score: 70.68
Seq: GGGTTGTTAGCTCAGACtGGTAGAGCACTTGGCTTTTAACCAATTGGtCGTAGGTTCAAATCCTATACAACTCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr.trna27 (93431-93359)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (93398-93396)	Score: 63.28
Seq: GGGTTTATAACTCAATGGTtAGAGTAGAGGACTCATAATTCTTTAGtTGTAGGTTCGACTCCTACTAAACCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna28 (37710-37638)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (37677-37675)	Score: 67.64
Seq: GGTTATATAGCTCAGTTGGTAGAGCAAATCATTCATGATGATTGGGtCTCCTGTTCAAATCAGGATATAACTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna20 (116581-116653)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (116614-116616)	Score: 71.11
Seq: TGCGGGGTAGAGCAGATGGTAGCTCATCGGGCTCATAATCCGAAGGtCGATGGTTCGAATCCATTCTCCGCAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna9 (53154-53226)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (53187-53189)	Score: 79.00
Seq: GGCTAAATAGCTCAGTAGGTAGAGCAAAGGACTGAAAATCCTTGTGtCGGTGGTTCGATTCCACCTTTAGCTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna13 (65163-65236)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (65197-65199)	Score: 63.78
Seq: CGGAATATAGCGTAGTTtGGTAACGTACTTGCTTTGGGAGTAAGTGAtCAAAGGTTCAAATCCTTTTATTCCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna23 (147001-146931)	Length: 71 bp
Type: Trp	Anticodon: CCA at 33-35 (146969-146967)	Score: 38.83
Seq: AAGTCAATAACTTAACGGTAAAGTATTGATTTCCAAAATCAATAATAGAGGTTCAATTCCTCTTTGGCTTG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna18 (96209-96279)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (96241-96243)	Score: 26.94
Seq: GGCTGAATAACATATAGGTtATGTCTTAGGTTGCAAACCTAATTAAATTGGTTCGAATCCAATTTCAGCTT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna4 (35535-35619)	Length: 85 bp
Type: Ser	Anticodon: GGA at 35-37 (35569-35571)	Score: 48.96
Seq: AGAGATATGTCTGAGTGGAttAAAGAATATGTTTGGAATACATATAAAACTAATGTTTTCATGGGTTCGAATCCCATTGTCTCTT
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna17 (80487-80565)	Length: 79 bp
Type: Leu	Anticodon: TAG at 34-36 (80520-80522)	Score: 43.73
Seq: ACCGAACTGTTGAAATGGTaAACAATCAAGATTTAGAATCTTGTGCTAACGCTTAGGAGTTCAAATCTCCTGTTCGGTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna24 (99023-98942)	Length: 82 bp
Type: Ser	Anticodon: GCT at 35-37 (98989-98987)	Score: 62.66
Seq: AGAGAAATGGCTGAGCGGTttAAAGCACTCCTCTGCTAAAGGAGTATAGAATCTAtCGTAGGTTCGAATCCTACTTTCTCTA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>.>...<.<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna16 (69415-69499)	Length: 85 bp
Type: Ser	Anticodon: TGA at 35-37 (69449-69451)	Score: 58.23
Seq: GGAAAGATGGTAGAGTGGTttAATACATCGGTCTTGAAAACCGATAAAGTTTAtTCTTtCCAGGGTTCGAATCCCTGTCTTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>.....<.<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna11 (53302-53373)	Length: 72 bp
Type: Thr	Anticodon: TGT at 34-36 (53335-53337)	Score: 58.28
Seq: GCTTTTGTAGCTTAGTAGGTAAAGCTGTTGATTTGTAATCAACTGtCTCGGGTTCGATTCCTGACAAAAGTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna21 (147179-147099)	Length: 81 bp
Type: Tyr	Anticodon: GTA at 35-37 (147145-147143)	Score: 49.13
Seq: GAAGAAATACCTAAGAGGTcaACAGGAACAGATTGTAAATCTGCTGCGAAAGCTtCAGAGGTTCGAATCCTCTTTTCTTCA
Str: >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>....<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna6 (48215-48287)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (48248-48250)	Score: 60.97
Seq: AGGTAATTAACTCAATAGGTAGAGTATCAGTTTTACATACTGAAAGtTATAAGTTCAAATCTTATATTACCTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.