GtRNAdb

tRNAscan-SE Analysis of Caulobacter crescentus

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna27 (3880543-3880468)	Length: 76 bp
Type: Ala	Anticodon: CGC at 34-36 (3880510-3880508)	Score: 90.21
Seq: GGGGCCGTAGCTCAGATGGTAGAGCGCCTCGTTCGCAATGAGGAGGtCAGGGGTTCGATTCCCCTCGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (3848459-3848534)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (3848492-3848494)	Score: 89.04
Seq: GGGGCTATAGCTCAGCTGGTAGAGCGCTTGAATGGCATTCAAGAGGtCAGCGGTTCGACTCCGCTTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna30 (3769868-3769793)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (3769835-3769833)	Score: 95.36
Seq: GGGGCCATAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGtCGTCGGTTCGAATCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr.trna35 (2839837-2839762)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (2839804-2839802)	Score: 95.36
Seq: GGGGCCATAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGtCGTCGGTTCGAATCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr.trna2 (556002-556078)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (556036-556038)	Score: 85.54
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGCATCAGACTACGAATCTGAGGGtCGGACGTTCGAATCGTTCCGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna51 (200201-200125)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (200167-200165)	Score: 86.37
Seq: GCACCCGTAGCTCAGCTGGAtAGAGCGTTGCCCTCCGAAGGCAAAGGtCACACGTTCGAATCGTGTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna49 (694411-694335)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (694377-694375)	Score: 86.31
Seq: GGCCCGGTAGCTCAGCAGGAtAGAGCAGCGCTTTCCTAAAGCGAAGGtCGGGGGTTCGAGTCCCTCCCGGGCCGCCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (1540882-1540958)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (1540916-1540918)	Score: 91.41
Seq: GCGCCCTTAGCTCAGACGGAtAGAGCATTCGCCTTCTAAGCGAACGGtCGCAGGTTCGAATCCTGCAGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna10 (1465800-1465874)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (1465832-1465834)	Score: 92.60
Seq: TCCGCGGTAGCTCAGTGGTAGAGCAGCCGGCTGTTAACCGGCTGGtCGTAGGTTCGAATCCTACCCGCGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna11 (1466010-1466084)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (1466042-1466044)	Score: 92.60
Seq: TCCGCGGTAGCTCAGTGGTAGAGCAGCCGGCTGTTAACCGGCTGGtCGTAGGTTCGAATCCTACCCGCGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna19 (2151696-2151772)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2151730-2151732)	Score: 96.44
Seq: GCGGATGTAGCTCAGTTGGTtAGAGCGCCGGCCTGTCACGCCGGAGGtCGCGGGTTCGAGCCCCGTCATTCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (2151837-2151913)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2151871-2151873)	Score: 96.44
Seq: GCGGATGTAGCTCAGTTGGTtAGAGCGCCGGCCTGTCACGCCGGAGGtCGCGGGTTCGAGCCCCGTCATTCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (2582010-2582083)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (2582042-2582044)	Score: 76.46
Seq: GGCCCGGTGGCGGAGTGGTGACGCAGCGGACTGCAAATCCGTGCACGCCGGTTCGATTCCGGCCCGGGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (1031170-1031243)	Length: 74 bp
Type: Gln	Anticodon: TTG at 33-35 (1031202-1031204)	Score: 58.25
Seq: TGGGGAATGGTGTAATGGTAACACTGCGGTTTTTGGTACCGTCAtTCTAGGTTCGAGTCCTAGTTCCCCAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna13 (1538900-1538974)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (1538933-1538935)	Score: 57.79
Seq: GGTCCCTTCGTCTATCGGTtAGGACGCCAGATTTTCAATCTGGAGAGAGGGGTTCGACTCCCCTAGGGACTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (1539020-1539094)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (1539053-1539055)	Score: 57.79
Seq: GGTCCCTTCGTCTATCGGTtAGGACGCCAGATTTTCAATCTGGAGAGAGGGGTTCGACTCCCCTAGGGACTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna21 (2430972-2431046)	Length: 75 bp
Type: Gly	Anticodon: CCC at 33-35 (2431004-2431006)	Score: 87.58
Seq: GCGGGCGTAGTTCAGAGGTAGAACGTCAGCTTCCCAAGCTGAATGtCGGGGGTTCGATTCCCCCCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna6 (1187706-1187780)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (1187738-1187740)	Score: 91.12
Seq: GCGGGCGTAGCTCAGTGGTAGAGCGCCACCTTGCCAAGGTGGATGtCGAGAGTTCGAATCTCTTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (1187831-1187905)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (1187863-1187865)	Score: 91.12
Seq: GCGGGCGTAGCTCAGTGGTAGAGCGCCACCTTGCCAAGGTGGATGtCGAGAGTTCGAATCTCTTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (1397384-1397457)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (1397416-1397418)	Score: 78.75
Seq: GCGGGTATAGCACAATGGTAGTGCAGCAGCCTTCCAAGCTGAGGATGCGGGTTCGATTCCCGCTACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna39 (2537440-2537364)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (2537406-2537404)	Score: 85.87
Seq: GCCGGCTTAGCTCAGTTGGTtAGAGCGCTAGATTGTGGATCTAGAGGtCCTCGGTTCGAGCCCGAGAGCTGGTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna29 (3770012-3769936)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (3769978-3769976)	Score: 92.03
Seq: AGGCCTGTAGCTCAGGTGGTtAGAGCGTACGCCTGATAAGCGTAAGGtCGGCAGTTCGAGTCTGCCCAGGCCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (2839981-2839905)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (2839947-2839945)	Score: 92.03
Seq: AGGCCTGTAGCTCAGGTGGTtAGAGCGTACGCCTGATAAGCGTAAGGtCGGCAGTTCGAGTCTGCCCAGGCCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (2395908-2395824)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (2395874-2395872)	Score: 72.11
Seq: GCGGGCGTGGTGAAACTGGTaGACGCGCCGGACTCAAAATCCGGTTCCGAAAGGAGTGTCGGTTCGACCCCGACCGCCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (3856869-3856783)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (3856835-3856833)	Score: 79.22
Seq: GCCCAGGTGGCGGAATTGGTaGACGCGCTGGCTTCAGGTGCCAGTGACCGAAAGGTCGTGGAGGTTCGAGTCCTCTCCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (2383007-2382923)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (2382973-2382971)	Score: 70.40
Seq: GCGGTCGTGGCGGAATTGGTaGACGCGCAGCGTTGAGGTCGCTGTGGGGCAACCCGTGGAAGTTCGAGTCTTCTCGACCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (2893438-2893522)	Length: 85 bp
Type: Leu	Anticodon: TAA at 35-37 (2893472-2893474)	Score: 74.42
Seq: GGGGACGTGGCGGAATCGGTaGACGCGCCGGACTTAAAATCCGTTGGAGCAATCCGTGTGGGTTCGAGTCCCACCGTCCCTACCA
Str: >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna43 (2162672-2162588)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (2162638-2162636)	Score: 76.79
Seq: GCGGATGTGGCGAAACTGGTaGACGCACTGGATTTAGGTTCCAGCGCCGCGAGGCGTGGAGGTTCGAGTCCTCTCATCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (1265691-1265616)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (1265658-1265656)	Score: 97.50
Seq: GGGTGTATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGtCCAAGGTTCGAATCCTTGTACACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1756063-1756137)	Length: 75 bp
Type: Lys	Anticodon: TTT at 33-35 (1756095-1756097)	Score: 93.63
Seq: GGGCCGGTAGCTCAGTGGTAGAGCATTCGACTTTTAATCGAATGGtCCTGGGTTCGAGTCCCAGCCGGCCTACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna31 (3766425-3766349)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3766391-3766389)	Score: 81.53
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGtCACAGGTTCAAATCCTGTCCCCGCACCCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna36 (2836394-2836318)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2836360-2836358)	Score: 81.53
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGtCACAGGTTCAAATCCTGTCCCCGCACCCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna40 (2495562-2495487)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (2495529-2495527)	Score: 81.76
Seq: GGGCCTGTAGCTCAATGGTtAGAGCCGACCGCTCATAACGGTCTGGtTGGGGGTTCGAGTCCCTCCGGGCCTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna33 (3417958-3417882)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3417924-3417922)	Score: 82.05
Seq: GGCTGGGTAGCTCAGATGGTtAGAGCGGTGGATTCATAACCCACAGGtCGGCGGTTCGATCCCGCCCCCCGCCACCA
Str: >>>.>>>..>>>>.........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<.<<<....
                    
chr.trna47 (1068550-1068474)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1068516-1068514)	Score: 82.05
Seq: GGCTGGGTAGCTCAGATGGTtAGAGCGGTGGATTCATAACCCACAGGtCGGCGGTTCGATCCCGCCCCCCGCCACCA
Str: >>>.>>>..>>>>.........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<.<<<....
                    
chr.trna38 (2542752-2542677)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (2542719-2542717)	Score: 92.55
Seq: GCCTGGGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGtCGCTGGTTCGATTCCGGCCCCAGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna48 (1031005-1030929)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (1030971-1030969)	Score: 87.55
Seq: CGGAGTGTGGCTCAGTCtGGTAGAGCACTGCGTTCGGGACGCAGGGGtCGCAGGTTCAAATCCTGCCACTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna12 (1523391-1523467)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (1523425-1523427)	Score: 83.53
Seq: CGGAGCGTGGCGCAGCCtGGTAGCGCACTTGACTGGGGGTCAAGGGGtCGCAGGTTCGAATCCTGTCGCTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna15 (1540445-1540521)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (1540479-1540481)	Score: 84.27
Seq: CGGAGCGTAGCGCAGCCtGGTAGCGCATCTGTTTTGGGAGCAGAGGGtCGCAGGTTCAAATCCTGCCGCTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna50 (473144-473055)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (473110-473108)	Score: 74.74
Seq: GGAGAGGTGGCAGAGTGGTcgAATGCGCCGCACTCGAAATGCGGTTTACGTGAAAGCGTAACGTGGGTTCGAATCCCACCCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna37 (2630527-2630437)	Length: 91 bp
Type: Ser	Anticodon: GCT at 35-37 (2630493-2630491)	Score: 68.28
Seq: GGAGACGTGGCCGAGAGGCtgAAGGCACCGCTTTGCTAAAGCGGCATACCTCAAaaGGGTAtCGAGGGTTCGAATCCCTCCGTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<....>>......<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (1115924-1116013)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (1115958-1115960)	Score: 74.61
Seq: GGTGAGGTGGCCGAGTGGTtgAAGGCGCACGCCTGGAACGCGTGTATAGGGGAAACTCTATCGAGGGTTCGAATCCCTCTCTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna18 (2018493-2018582)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (2018527-2018529)	Score: 78.98
Seq: GGACAGGTGGCCGAGTGGTttAAGGCAGCGGTCTTGAAAACCGCCGTAGGTGGAAGCCTACCGTGGGTTCGAATCCCACCCTGTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna1 (76150-76225)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (76183-76185)	Score: 87.10
Seq: GCCGCCTTAGCTCAGCCGGTAGAGCGGCGCATTCGTAATGCGTAGGtCAGGTGTTCGAGTCACCTAGGCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna23 (2551641-2551715)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (2551673-2551675)	Score: 85.05
Seq: GCCGCCGTAGCTCAGTGGTAGAGCGCATCCTTGGTAAGGCTGAGGtCGGCAGTTCAATCCTGCCCGGCGGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>.>>.......<<.<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna45 (1374032-1373958)	Length: 75 bp
Type: Thr	Anticodon: TGT at 33-35 (1374000-1373998)	Score: 85.16
Seq: GCCGGCTTAGCACAGCGGTAGTGCAGCGGTTTTGTAAACCGAAGGtCGGGGGTTCGATCCCCTCAGCCGGCACCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (3461519-3461444)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (3461486-3461484)	Score: 87.30
Seq: AGGAGTGTAGCTCAGCTGGTAGAGCATCGGTCTCCAAAACCGAGGGcCGGGGGTTCGAGTCCCTCCACTCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna8 (1397190-1397273)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 33-35 (1397222-1397224)	Score: 53.83
Seq: GGGAATGtCCCGAGTGGCaAAGGGGGGGGACTGTAAATCCCCTGGCGTAAGCCTtCGTAGGTTCGAGTCCTACTTCCCCCACCA
Str: >>>>>...>>>..........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<......
                    
chr.trna22 (2509083-2509157)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (2509115-2509117)	Score: 86.65
Seq: GGATGCGTAGCTCAGCGGGAGAGCACCTCGTTCACACCGAGGGGGtCACAGGTTCAATCCCTGTCGCATCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna3 (816274-816348)	Length: 75 bp
Type: Val	Anticodon: GAC at 33-35 (816306-816308)	Score: 85.42
Seq: GGACGCGTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGtCACAGGTTCAATCCCTGTCGCGTCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (2154567-2154493)	Length: 75 bp
Type: Val	Anticodon: TAC at 33-35 (2154535-2154533)	Score: 90.05
Seq: GGGCAGTTAGCTCAGCGGTAGAGCGTCTCGTTTACACCGAGAGGGtCGGGGGTTCGATCCCCTCACTGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.