GtRNAdb

tRNAscan-SE Analysis of Chlamydia muridarum

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna37 (5490-5418)	Length: 73 bp
Type: Ala	Anticodon: GGC at 34-36 (5457-5455)	Score: 74.81
Seq: GGGGTATTAGCTCAGTTGGTAGAGCGCAACAATGGCATTGTTGAGGtCAGCGGTTCGATCCCGCTATGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna26 (550765-550693)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (550732-550730)	Score: 82.13
Seq: GGGGACTTAGCTTAGTTGGTAGAGCGTCTGATTTGCATTCAGAAGGtCAGGAGTTCGAATCTCCTAGTCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna14 (1035374-1035302)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (1035341-1035339)	Score: 76.99
Seq: GCACCAGTAGCTCAGTGGAtAGAGTACCTGGCTACGAACCAGGTGGtCAGAGGTTCAAATCCTCTCTGGTGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna11 (896399-896472)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (896433-896435)	Score: 75.01
Seq: GCACCGATAGCTCAACTGGAtAGAGTACCTGGCTTCGGACCAGGTGGtTGGAGGTTCGAACCCTCTTCGGTGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna1 (32623-32695)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (32656-32658)	Score: 87.30
Seq: GGACCGATAGCTCAGTGGAtAGAGCATCCGCCTTCTAAGCGGATGGtCGCAGGTTCGAATCCTGCTCGGTCCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna29 (364731-364660)	Length: 72 bp
Type: Asn	Anticodon: GTT at 33-35 (364699-364697)	Score: 75.21
Seq: TCCGGAGTAGCTCAGCGGTAGAGCAGTGGACTGTTAATCCATTGGtCGTTGGTTCGAACCCATCCTCCGGAG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna23 (601626-601553)	Length: 74 bp
Type: Asp	Anticodon: GTC at 35-37 (601592-601590)	Score: 77.52
Seq: GCGGGAGTAGTTCAATTGGTtAGAGCACCGCCCTGTCAAGGCGGAAGtTGCGGGTTCGAGCCCCGTCTCTCGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna31 (167619-167549)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (167587-167585)	Score: 61.76
Seq: GGTGGCATCGCCAAGCGGTAAGGCCGAGGCCTGCAAAGCCTCTAtCCCCGGTTCGATTCCGGGTGCCACCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna3 (216411-216482)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (216443-216445)	Score: 63.88
Seq: TGGGGTGTGGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGCGCAtCGGAGGTTCGAATCCTTCCACCCCAG
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna35 (55189-55115)	Length: 75 bp
Type: Glu	Anticodon: TTC at 37-39 (55153-55151)	Score: 50.11
Seq: GGCCCCATCGTCTAGCCtGGCccAGGACATCGGATTTTCATTCCGGTAACAGGGGTTCGAATCCCCTTGGGGTCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna33 (94367-94296)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (94335-94333)	Score: 75.06
Seq: GCGGGTGTAGCTCAGTGGTAGAGCGCCACGTTGCCAACGTGAAGGtCGTGAGTTCAAGCCTCATCACCCGCT
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr.trna34 (58425-58355)	Length: 71 bp
Type: Gly	Anticodon: TCC at 33-35 (58393-58391)	Score: 69.63
Seq: GCGCCCGTAGCTCAATGGTAGAGCTGTAGCCTTCCAAGCTACCGGTGTCAGTTCGATTCTGATCGGGCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna32 (133288-133215)	Length: 74 bp
Type: His	Anticodon: GTG at 35-37 (133254-133252)	Score: 81.22
Seq: GCGAACGTAGCTCAGTTGGTtAGAGCGTCGGATTGTGGTTCCGAAGGtCGCGGGTTCGAACCCCGTCGTTCGCC
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna27 (550688-550615)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (550654-550652)	Score: 83.91
Seq: GCGGTTATAGCTCAGTTGGTtAGAGCGCGACACTGATAATGTCGAGGtCCCAAGTTCAAGTCTTGGTAACCGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna10 (893599-893681)	Length: 83 bp
Type: Leu	Anticodon: CAA at 34-36 (893632-893634)	Score: 63.24
Seq: GCCGGCGTGGCGGAATGGTaGACGCGGTAGACTCAAAATCTACTCTTAGCAGTAAGGTGTTGGTTCGAGTCCAATCGCCGGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna12 (958000-958086)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (958034-958036)	Score: 56.15
Seq: GCAGCTATGGCGGAACCGGTaGACGCGCTAGATTCAGGTTCTAGTGAGCTTTTGCTCaTGGAAGTTCAAGTCTTCTTAGCTGCAACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (898609-898528)	Length: 82 bp
Type: Leu	Anticodon: GAG at 35-37 (898575-898573)	Score: 51.25
Seq: GCGGAAGTGGCGGAATTGGTaTACGCGCTATCTTGAGGTGGTAGTGGAGCTTTCCtTAGGGGTTCGAGTCCCCTCTTTCGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>..<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna15 (934391-934309)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (934358-934356)	Score: 58.49
Seq: GCTCAGATGGTGGAATGGTaGACACTAGGGACTTAAAATCCCTTGGGCTTTGGCCCGTGCAAGTTCGAGTCTTGTTCTGAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna5 (297053-297134)	Length: 82 bp
Type: Leu	Anticodon: TAG at 35-37 (297087-297089)	Score: 61.09
Seq: GCCCAGGTGGTGAAATTGGTaGACACGCTGGATTTAGGATCCAGTGCTTTGCGGCATGTAGGTTCAAGTCCTATCCTGGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna36 (55097-55025)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (55064-55062)	Score: 83.84
Seq: GGGTCTTTAGCTCAGCGGTtAGAGCATCTCACTTTTAATGAGAGGGtCGCAGGTTCGAATCCTTCAAGACCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna24 (582970-582898)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (582937-582935)	Score: 71.20
Seq: CGCGGGATAGAGTAGTGGTcATCTCGTTGGGCTCATAACCCAAAGGtCGGAGGTTCGAATCCTTCTCCCGCTA
Str: .>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr.trna25 (582881-582808)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (582847-582845)	Score: 73.61
Seq: GGCGGTATAGCTCAGGTGGTtAGAGCAGCGGAATCATAATCCGCGTGtCGTTGGTTCAAGTCCGACTACCGCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna8 (718864-718936)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (718897-718899)	Score: 78.30
Seq: GGGGCAATAGCTCAGCGGTtAGAGCTGCGGACTCATAACCCGTAGGtCCCTGGTTCAAATCCAGGTTGCCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna18 (842701-842629)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (842668-842666)	Score: 76.09
Seq: GGCTAGATAGCTCAGCTGGTAGAGCAGAGGACTGAAGATCCTTGTGtCGTCGGTTCGATCCCGGCTCTGGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna13 (1071248-1071321)	Length: 74 bp
Type: Pro	Anticodon: GGG at 35-37 (1071282-1071284)	Score: 67.00
Seq: CTGGATGTAGCGCAGCCtGGTAGCGCACTTGCATGGGGTGCAAGGGGgCGGAGGTTCAAATCCTCTCATCCAGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna28 (390146-390072)	Length: 75 bp
Type: Pro	Anticodon: TGG at 36-38 (390111-390109)	Score: 78.14
Seq: CGGAGTATAGCGCAGCCtGGTtAGCGCGGTTGCTTTGGGAGCAATAGGtCGGGGGTTCGAATCCCTCTACTCCGA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna9 (763201-763287)	Length: 87 bp
Type: Ser	Anticodon: CGA at 35-37 (763235-763237)	Score: 62.46
Seq: GGAAGAGTGGCAGAGTGGTcgAATGCATCTGATTCGAAATCAGAAGTCCCTCAAcGGGGAcCGGGGGTTCAAATCCCTTCTCTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>.....<<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna16 (927358-927270)	Length: 89 bp
Type: Ser	Anticodon: GCT at 35-37 (927324-927322)	Score: 59.15
Seq: GGAAAGATGACTGAGTGGTcgAAAGTACGTCCCTGCTAAGGACGCGTACCCCTTAAAGGGTACCGAGGGTTCGAATCCCTCTCTTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>......<<<<<<.>>>>>.......<<<<<<<<<<<<.
                    
chr.trna19 (837963-837877)	Length: 87 bp
Type: Ser	Anticodon: GGA at 35-37 (837929-837927)	Score: 65.29
Seq: GGAGAGATGTCCGAGTGGCttAAGGAGCACGCTTGGAAAGCGTGTGTGCGTTAACGCGTACCGAGGGTTCGAATCCCTCTCTCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<.
                    
chr.trna4 (263371-263455)	Length: 85 bp
Type: Ser	Anticodon: TGA at 35-37 (263405-263407)	Score: 70.17
Seq: GGAAGAATGGCAGAGCGGTttAATGCACCTGTCTTGAAAACAGGAGACCTGAAAGGGTCCGGGGGTTCGAATCCCTCTTCTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna2 (53171-53243)	Length: 73 bp
Type: Thr	Anticodon: CGT at 34-36 (53204-53206)	Score: 76.52
Seq: GCCTAAATAGCTCAGTTGGTAGAGCAACGCATTCGTAACGCGTAGGtCGTCGGTTCGATCCCGGCTTTGGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna20 (713652-713581)	Length: 72 bp
Type: Thr	Anticodon: GGT at 33-35 (713620-713618)	Score: 75.30
Seq: GCCCAGGTAGCTCAGTGGTAGAGCACTTGCATGGTAAGCAAGTGGcCGTAGGTTCAATTCCTATTCTGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna6 (479293-479365)	Length: 73 bp
Type: Thr	Anticodon: TGT at 34-36 (479326-479328)	Score: 80.09
Seq: GCTGGAGTAGCTCAATTGGCAGAGCATTCGATTTGTAATCGAACGGtTGAGGGTTCAATTCCTTTCTCCAGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna21 (712297-712225)	Length: 73 bp
Type: Trp	Anticodon: CCA at 34-36 (712264-712262)	Score: 70.24
Seq: GGGTGTGTAGCTTAGATGGTAGAGCAGTGGCCTCCAAAGCCGCCGGtCGGGGGTTCGAATCCCTCCGCACTCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna7 (479373-479455)	Length: 83 bp
Type: Tyr	Anticodon: GTA at 35-37 (479407-479409)	Score: 56.66
Seq: GGGGGTGTCGCATAGCGGTcaATTGCATCGGACTGTAAATCCGACTCCTTACGGATaCGTTGGTTCAAATCCAGCCACCCCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna30 (258680-258607)	Length: 74 bp
Type: Val	Anticodon: GAC at 35-37 (258646-258644)	Score: 72.25
Seq: GGGGTATTAGCTCAGTTGGTtAGAGCGTCACGTTGACATCGTGAAGGtCAGCTGTTCAAGTCAGCTATATCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna22 (601706-601634)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (601673-601671)	Score: 78.56
Seq: GGATGCGTAGCTCAGCGGTtAGAGCACCTGTCTTACACACAGGGGGtCATAGGTTCAAATCCTGTCGTGTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.