GtRNAdb

tRNAscan-SE Analysis of Encephalitozoon cuniculi

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chrVII.trna3 (177782-177853)	Length: 72 bp
Type: Ala	Anticodon: AGC at 33-35 (177814-177816)	Score: 71.92
Seq: GGGGAGTTAGCTCAGCGGTAGAGCGCTTGCTTAGCATGTAAGAGGtCATGGGTTCAAATCCCATATTCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrX.trna3 (147667-147737)	Length: 71 bp
Type: Ala	Anticodon: CGC at 33-35 (147699-147701)	Score: 62.98
Seq: GGGGGATTATCTTAGTGGTAGAGTGTTTGCTTCGCATGCAAGTGGCCCGGGTTCGATTCCTGGATCCTCCA
Str: >>>>>>>...>>>.......<<<..>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrII.trna4 (117723-117653)	Length: 71 bp
Type: Ala	Anticodon: TGC at 33-35 (117691-117689)	Score: 64.13
Seq: GGGGTTGTGGTCTAGTGGTATGATACCTGCTTTGCACGCAGTTGGCCCGGGTTCGATTCCTGGCAACTCCA
Str: >>>>>>>..>>>.........<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrVI.trna2 (165236-165308)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (165269-165271)	Score: 74.98
Seq: GGCCTCATAGCTCAATGGTtAGAGTGTCGGCCTACGGAGCCGAAGGcTGAGGGTTCGAGTCCCTCTGGGGTCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrIX.trna1 (158716-158788)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (158749-158751)	Score: 75.43
Seq: GTTCCTGTAGCTCAGTCGGTAGAGCGCGGCTCTCCTAAAGCTGAGGtCGTGGGTTCAAGTCCCACCTGGAACG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chrVII.trna1 (171161-171231)	Length: 71 bp
Type: Arg	Anticodon: TCG at 33-35 (171193-171195)	Score: 59.32
Seq: GGGTCCTTAGTATAATGGTAGAACACTTGGCTTCGGACCAAATAGTCCGGGTTCGAATCCCGGAGGACTCG
Str: >>>>>>>..>>.>.......<.<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrVIII.trna6 (79525-79453)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (79492-79490)	Score: 71.33
Seq: GCCCTGATAGCGTAATGGCtAACGCGTCTGCCTTCTAAGCAGAAGAcTGCGGGTTCGAGTCCCGCTCAGGGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrX.trna5 (17842-17770)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (17809-17807)	Score: 83.88
Seq: GCCTTTGTAGCGCAGTGGTtAACGCGTTCGGCTGTTAACCGAAAGGtCGAGAGTTCGAGTCTCTCCAAGGGCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrVIII.trna3 (213588-213660)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (213621-213623)	Score: 85.33
Seq: GCCTCTGTAGCGCAGTGGTtAACGCGTTCGGCTGTTAACCGAAAGGtCGAGAGTTCGAGTCTCTCCAGGGGCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrIII.trna4 (44699-44627)	Length: 73 bp
Type: Asp	Anticodon: GTC at 35-37 (44665-44663)	Score: 71.89
Seq: TCTTCCATAGTGTAGTGGTatATCATATCCGCCTGTCACGCGGGTGACCCGGGTTCGAATCCCGGTGGGAGAG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrVIII.trna1 (68209-68280)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (68241-68243)	Score: 68.17
Seq: GGGTCCGTAGCTCAGCGGTAGAGCAATTGATTGCAGATCAATCGGtCACAGGTTCGATTCCTGTCGTGCCCT
Str: >>>>.>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chrVI.trna3 (201539-201610)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (201572-201574)	Score: 68.22
Seq: GGTTGCGTGGTGTAATGGTtATCACTTCAGACTCTGAATCTGACAATCTGAGTTCGAATCTCGGCGCGACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrVII.trna5 (32167-32096)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (32134-32132)	Score: 68.54
Seq: GGTTCCATAGTGTAATGGTtAGCACCCTGGACTTTGAATCCAGTAATCTGAGTTCGAATCTCGGTGGAACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrVIII.trna7 (32736-32665)	Length: 72 bp
Type: Glu	Anticodon: CTC at 34-36 (32703-32701)	Score: 77.09
Seq: TCCTTGTTGGTCCAGTGGTtAGGATAGCTGCCTCTCACGCAGCAGGCTCGGGTTCGATTCCCGGACGAGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrIX.trna2 (210542-210613)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (210575-210577)	Score: 68.61
Seq: TTCCTACTGGTCTAGCGGTtAGGATGTCTGCCTTTCAAGCAGGAGGTGGGGGTTCGATTCCCCCGTAGGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrXI.trna2 (158598-158669)	Length: 72 bp
Type: Gly	Anticodon: CCC at 34-36 (158631-158633)	Score: 77.77
Seq: GCATTGGTAGTATAGTGGTtATTATGTGAGCTTCCCAAGCTCATGGCCCGGGTTCGATTCCCGGTCAATGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrVI.trna4 (54370-54300)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (54338-54336)	Score: 66.16
Seq: GCATCATTGGTTTAGTGGTATAATGGCCGGTTGCCATCTGGCCGACCCGAGTTCGATTCTCGGATGATGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrI.trna1 (55599-55670)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (55632-55634)	Score: 72.96
Seq: GCGTTGTTGGTCTAGTGGAtAGGATAACAGCCTTCCAAGCTGTTGGCCCGGGTTCGATTCCCGGACATCGCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<.<<<.
                    
chrIX.trna3 (221638-221708)	Length: 71 bp
Type: His	Anticodon: GTG at 33-35 (221670-221672)	Score: 69.11
Seq: GCTGAATTAGCTTAGTGGTAGAGCATGGCGTTGTGGCCGCCAAGATGCGAGTTCGATTCTCGCATTCAGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrIV.trna1 (25454-25527)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (25488-25490)	Score: 75.71
Seq: GTTCTGGTAGCTCAGTCGGTcAGAGCGTCGTGCTAATAACGCGAAGGtCCAGGGTTCGAGCCCCTGTCGGAACA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrIV.trna2 (57467-57581)	Length: 115 bp
Type: Ile	Anticodon: TAT at 35-37 (57501-57503)	Score: 68.39
Possible intron: 39-79 (57505-57545)
Seq: GCCCCCGTAGCTCAGTCGGTcAGAGCGTGGTACTTATAtgctggaaagctgtgcaaaacttggcttacactgctaagatATGCCAAGGtCGCGGGTTCGAGCCCCGCTGGAGGCA
Str: >>>.>>>..>>>>.........<<<<.>>>>>................................................<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chrII.trna3 (179296-179377)	Length: 82 bp
Type: Leu	Anticodon: AAG at 35-37 (179330-179332)	Score: 69.09
Seq: GGTTGGATGGCCGAGTGGTccAAGGCGCTGGCTTAAGGTGCCAGTCTCTCAGGAGGCGTGGGTTCGAACCCCACTCCAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<.
                    
chrIV.trna5 (119683-119602)	Length: 82 bp
Type: Leu	Anticodon: CAA at 35-37 (119649-119647)	Score: 62.09
Seq: GGGACTTTGGCCGAGTGGTctAAGGCGCTCGATTCAAGACTGAGTACGGTAACGTtCGGGGGTTCGAATCCCCCAGGTCCCA
Str: >>>>>>>..>>>...........<<<.>>>>.........<<<<..>>.><.<<...>>>>>.......<<<<<<<<<<<<.
                    
chrVII.trna4 (113069-112989)	Length: 81 bp
Type: Leu	Anticodon: CAG at 35-37 (113035-113033)	Score: 70.62
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGGTACGTTCAGGTCGTATTCTCATTGAGGCACGGGTTCGAATCCCGTTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<..>>>>>.......<<<<<<<<<<<<.
                    
chrV.trna1 (87231-87313)	Length: 83 bp
Type: Leu	Anticodon: TAA at 35-37 (87265-87267)	Score: 67.07
Seq: GGTGGTGTGGCCGAGCGGTctAAGGCGGCAGACTTAAGATCTGTTATCGGGAGATAtCGTGGGTTCGAATCCCATCGCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<.
                    
chrXI.trna3 (53750-53670)	Length: 81 bp
Type: Leu	Anticodon: TAG at 35-37 (53716-53714)	Score: 62.34
Seq: GGTACAATGGCCGAGCGGTctAAGGCGCTGGAATTAGGCTCCAGTCTCATTGAGGCGGGGGTTCGAATCCCTCTTGTGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<..>>>>>.......<<<<<<<<<<<<.
                    
chrIV.trna6 (22702-22629)	Length: 74 bp
Type: Lys	Anticodon: CTT at 35-37 (22668-22666)	Score: 66.77
Seq: GCCTGGCTAGCTCAACAGGAtAGAGCGACAGACTCTTAATCTGTAGGcTGCGGGTTCGAGTCCCGCGCTGGGTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrVII.trna2 (172081-172153)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (172114-172116)	Score: 68.56
Seq: ACCCTGTTAGCTCAGTTGGAAGAGTGCTGGACTTTTAATCCAAGGGcCGTGGGTTCGAGTCCCGCACAGGGTG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chrIV.trna3 (180828-180900)	Length: 73 bp
Type: Met	Anticodon: CAT at 33-35 (180860-180862)	Score: 68.77
Seq: AGCATGGTAGCGCAACGGAAGCGCGCTGGGCTCATAACCCAGAGGtTGTGtGGTTCGAATCCCACCCATGCTA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>.>>.......<<<<<<<<<<<<.
                    
chrXI.trna1 (57751-57823)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (57784-57786)	Score: 68.89
Seq: GTGACATTGGCGCAATAGGTAGCGCGCTGGTCTCATAATCCAGAGGtTGCGAGTTCGAGTCTCGCATGTCGCA
Str: >>>>>>>..>>>>........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrIII.trna3 (132248-132177)	Length: 72 bp
Type: Phe	Anticodon: GAA at 33-35 (132216-132214)	Score: 74.22
Seq: GCTGGATTAGCTCAGTGGAAGAGCACTAGACTGAAGATCTAGGTGtCCCCGGTTCGAACCCGGGATCTAGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrII.trna2 (104134-104205)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (104166-104168)	Score: 65.64
Seq: GGTGGTATGGTCTAGCGGTATGACGCTTGCTTAGGGTGCAAGAGGcCTTGGGTTCGAATCCCAATACCGCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrX.trna2 (55869-55939)	Length: 71 bp
Type: Pro	Anticodon: CGG at 33-35 (55901-55903)	Score: 63.27
Seq: GGCGTCATGGTCCAATGGTACGATACGTGCTTCGGGTGCACGTGACCCGAGTTCGATTCTCGGTGACGCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrIV.trna4 (182891-182962)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (182923-182925)	Score: 60.91
Seq: GGCTCGGTGGTCTAAGGGTATGATCTCCGCTTTGGGTGCGGAGGGcTCCAGGTTCAAATCCTGGCCGAGCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrI.trna2 (93040-93123)	Length: 84 bp
Type: Ser	Anticodon: AGA at 36-38 (93075-93077)	Score: 69.38
Seq: GAAGACGTGtGCCGAGTGGTctAAGGCGCTGGTTTAGAAAACCAGTAGGCTCTGCCTGCGCAGGTTCGAATCCTGTCGTCTTCG
Str: >>>>>>>...>>>...........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chrII.trna5 (62756-62675)	Length: 82 bp
Type: Ser	Anticodon: CGA at 35-37 (62722-62720)	Score: 61.55
Seq: GGCGGTGTGGCCGAGTGGTcaAAGGCAATCGATTCGAAATCGATGGACTCTGTCCCCACAGGTTCGAATCCTGTCGCCGTCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chrX.trna1 (34328-34409)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (34361-34363)	Score: 74.68
Seq: GACCTCGTAGCAAAGTGGTtAACGCGGTAGATTGCTAATCTATTTCCTTCTGGGAGCGCGAGTTCGAATCTCGCCGAGGTCG
Str: >>>>>>>..>>............<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chrIII.trna1 (41045-41127)	Length: 83 bp
Type: Ser	Anticodon: TGA at 35-37 (41079-41081)	Score: 66.40
Seq: GGTGCCGTGGCCGAGTGGTccAAGGCGACGGATTTGAAATCCGTTGAGGTTCTCTCtCGCTGGTTCGAATCCAGTCGGCATCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>...<<<...>>>>>.......<<<<<<<<<<<<.
                    
chrV.trna2 (118514-118586)	Length: 73 bp
Type: Thr	Anticodon: AGT at 34-36 (118547-118549)	Score: 74.46
Seq: GCCGCCATAGCTAAGTGGTtATAGCGCCAGTTTAGTAAACTGGAGGcCCCGAGTTCGAGTCTCGGTGGTGGCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrII.trna1 (63209-63279)	Length: 71 bp
Type: Thr	Anticodon: CGT at 33-35 (63241-63243)	Score: 69.45
Seq: GGCTTGTTAGTTTAGTGGCAAAACGGTTGATTCGTAATCAACTGACGCGAGTTCGATTCTCGCACAAGCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chrVIII.trna4 (200354-200282)	Length: 73 bp
Type: Thr	Anticodon: TGT at 34-36 (200321-200319)	Score: 75.41
Seq: GCCATTATAGCTCAGTAGGTAGAGCTTTAGCTTTGTAAGCTAAGGGtCCTGGGTTCGAGTCCCAGTGGTGGCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrVI.trna1 (120887-120958)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (120919-120921)	Score: 63.04
Seq: GACGGTGTGGCGCAACGGTAGCGCGTCGGATTCCAGTCCCGAAGGtTCTAGGTTCAAATCCTGGCTCCGTCA
Str: >>>>>.>..>>>>.......<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chrVIII.trna5 (107482-107399)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 33-35 (107450-107448)	Score: 69.39
Possible intron: 37-48 (107446-107435)
Seq: CTCTCAATAGCTCAGTGGTAGAGCATTCGACTGTAGaggtgtgctgatATCGAATGGcCGCTGGTTCGACTCCAGCTTGGGAGA
Str: >>>>>>>..>>>>.......<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrVIII.trna2 (107288-107360)	Length: 73 bp
Type: Val	Anticodon: AAC at 34-36 (107321-107323)	Score: 73.81
Seq: GTGACCTTAGTGTAGTGGTtATCACGTTCGCCTAACACGCGGAAGGtCCCCAGTTCGAGCCTGGGAGGTCGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrX.trna4 (21671-21599)	Length: 73 bp
Type: Val	Anticodon: CAC at 34-36 (21638-21636)	Score: 76.98
Seq: GCTTTTGTAGTGTAGTGGTtATCACGTATCCTTCACACGGATGAGGtCCTCGGTTCGAACCCGAGCAAAAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chrIII.trna2 (152612-152684)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (152645-152647)	Score: 79.48
Seq: GCCCTTGTAGTGTAGTGGTtATCACGCATCCTTTACACGGATGAGGtCCTTGGTTCGATCCCGAGCGGGGGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.