GtRNAdb

tRNAscan-SE Analysis of Lactobacillus johnsonii NCC 533

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna18 (1888132-1888060)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1888099-1888097)	Score: 76.90
Seq: GGGGGCTTAGCTCAGATGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCATCGGTTCGATCCCGTTAGCCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna21 (1882617-1882545)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1882584-1882582)	Score: 76.90
Seq: GGGGGCTTAGCTCAGATGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCATCGGTTCGATCCCGTTAGCCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna29 (1680388-1680315)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (1680354-1680352)	Score: 70.13
Seq: GCACCCTTAGCGCAACTGGAtAGAGTGTCTGACTACGAATCAGAAGGtTGAAGGTTCAAATCCTTCAGGGTGCA
Str: >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna56 (1665939-1665866)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (1665905-1665903)	Score: 70.13
Seq: GCACCCTTAGCGCAACTGGAtAGAGTGTCTGACTACGAATCAGAAGGtTGAAGGTTCAAATCCTTCAGGGTGCA
Str: >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna14 (707462-707534)	Length: 73 bp
Type: Arg	Anticodon: CCT at 35-37 (707496-707498)	Score: 55.30
Seq: GACCCCGTAGTTCATCTGGAtAGAACAATGGTCTCCTAAACCGTAGAGGTGAGTTCGAATCTCACCGGGGTCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna73 (1454747-1454674)	Length: 74 bp
Type: Arg	Anticodon: TCT at 35-37 (1454713-1454711)	Score: 76.81
Seq: GGTTTGGTAGCTCAGCTGGAtAGAGCAACGGTCTTCTAAACCGTGGGtCGTGAGTTCGAATCTCACCCAAATCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna10 (563466-563538)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (563499-563501)	Score: 85.15
Seq: TCCGGCTTAGCTCAGTTGGTAGAGCACCTGACTGTTAATCAGGTTGtCGTCAGTTCGAGTCTGACAGCCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna22 (1879324-1879252)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (1879291-1879289)	Score: 85.15
Seq: TCCGGCTTAGCTCAGTTGGTAGAGCACCTGACTGTTAATCAGGTTGtCGTCAGTTCGAGTCTGACAGCCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna66 (1659788-1659716)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (1659755-1659753)	Score: 85.15
Seq: TCCGGCTTAGCTCAGTTGGTAGAGCACCTGACTGTTAATCAGGTTGtCGTCAGTTCGAGTCTGACAGCCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna19 (1884839-1884764)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (1884806-1884804)	Score: 93.45
Seq: TCCGGCTTAGCTCAGTTGGTAGAGCACCTGACTGTTAATCAGGTTGtCGTCAGTTCGAGTCTGACAGCCGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (1679936-1679864)	Length: 73 bp
Type: Asp	Anticodon: GTC at 34-36 (1679903-1679901)	Score: 62.03
Seq: GGTCCCTTGGTGTAGGGGTtATCACGCCTCCCTGTCACGGAGGAGAtCACCGGTCCGAATCCGGTAGGGACCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna61 (1665487-1665415)	Length: 73 bp
Type: Asp	Anticodon: GTC at 34-36 (1665454-1665452)	Score: 62.03
Seq: GGTCCCTTGGTGTAGGGGTtATCACGCCTCCCTGTCACGGAGGAGAtCACCGGTCCGAATCCGGTAGGGACCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna42 (1678034-1677962)	Length: 73 bp
Type: Asp	Anticodon: GTC at 34-36 (1678001-1677999)	Score: 75.58
Seq: GGTCCCTTAGTGTAGTGGTtATCACGCCTCCCTGTCACGGAGGAGAtCACCGGTTCGAGTCCGGTAGGGACCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna48 (1677533-1677463)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (1677501-1677499)	Score: 67.47
Seq: GGCGGTGTAGCCAAGTGGTAAGGCACGGGTCTGCAAAACCCTAAtCATCGGTTCAAATCCGATCACCGCCT
Str: >>>>>>>..>>>.........<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna16 (828382-828454)	Length: 73 bp
Type: Gln	Anticodon: CTG at 34-36 (828415-828417)	Score: 57.22
Seq: TGAGATATAGCCAAATTGGTAAGGCACAGGATTCTGGTTCCTGGATgTTTCGGTTCGAGCCCGAATATCTCAA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna68 (1633407-1633336)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (1633375-1633373)	Score: 62.43
Seq: TGGGTTATAGCCAAGTGGTAAGGCAATGGTTTTTGGTACCATCATgCGCTGGTTCGAATCCAGCTAACCCAA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna70 (1631363-1631292)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (1631331-1631329)	Score: 62.43
Seq: TGGGTTATAGCCAAGTGGTAAGGCAATGGTTTTTGGTACCATCATgCGCTGGTTCGAATCCAGCTAACCCAA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna47 (1677625-1677554)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (1677593-1677591)	Score: 63.39
Seq: TGGGATATAGCCAAGCGGTAAGGCAATGGACTTTGACTTCATCATgCGTTGGTTCGAATCCAACTATCCCAA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna15 (828305-828376)	Length: 72 bp
Type: Glu	Anticodon: CTC at 34-36 (828338-828340)	Score: 60.33
Seq: TGCCCGTTGGTCAAATGGTtAAGACGCCACCCTCTCAAGGTGGAGtTACGAGTTCAATTCTCGTACGGGTGA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna75 (1317009-1316937)	Length: 73 bp
Type: Glu	Anticodon: TTC at 35-37 (1316975-1316973)	Score: 60.61
Seq: GGCTCGTTGGTCAAGTGGTttAAGACACTGGTTTTTCATACCAGTAACACAAGTTCGATTCTTGTACGAGCTA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna7 (340727-340798)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (340760-340762)	Score: 62.50
Seq: GGCTCGTTGGTCAAATGGTcAAGACGCCACCCTTTCACGGTGGAGtTACAAGTTCAATTCTTGTACGAGCTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna12 (563769-563840)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (563802-563804)	Score: 63.58
Seq: GGCCCGTTGGTCAAGCGGTtAAGACACCGCCCTTTCACGGCGGTAACATGAGTTCAAATCTCGTACGGGTCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna39 (1678307-1678236)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1678274-1678272)	Score: 64.02
Seq: GACCCGTTGGTCAAGTGGTtAAGACACCGCCCTTTCACGGCGGTAACATGAGTTCAAATCTCGTACGGGTCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna77 (228961-228891)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (228929-228927)	Score: 54.31
Seq: GCGGGTATAGTTTAATGGTAAAATGTCAGCTTCCCAAGCTGAAGATGCGGGTTCGATTCACGCTATCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>.>.......<.<<<<<<<<<<.
                    
chr.trna27 (1680567-1680496)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (1680535-1680533)	Score: 83.89
Seq: GCGGAAGTAGTTCAGTGGTAGAACACCACCTTGCCATGGTGGGGGtCGCGGGTTCGAATCCCGTCTTCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna54 (1666118-1666047)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (1666086-1666084)	Score: 83.89
Seq: GCGGAAGTAGTTCAGTGGTAGAACACCACCTTGCCATGGTGGGGGtCGCGGGTTCGAATCCCGTCTTCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna4 (327595-327669)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (327627-327629)	Score: 87.51
Seq: GCGGAAGTAGTTCAGTGGTAGAACATCACCTTGCCATGGTGGGGGtCGCGGGTTCGAATCCCGTCTTCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (1679769-1679696)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (1679737-1679735)	Score: 66.15
Seq: GCGGGTATAGTTTAGTGGTAAAACGAAAGCCTTCCAAGCTTTAGtCGCGAGTCCGATTCTCGTTACCCGCTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna63 (1665320-1665247)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (1665288-1665286)	Score: 66.15
Seq: GCGGGTATAGTTTAGTGGTAAAACGAAAGCCTTCCAAGCTTTAGtCGCGAGTCCGATTCTCGTTACCCGCTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (1677705-1677630)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (1677672-1677670)	Score: 60.26
Seq: GCGGAATTGGTGAAGTGGTtAACACACCGGTTTGTGGATCCGGCATgCGTGGGTTCGATCCCCACATTCCGCCCTA
Str: >>>>>>>..>>>..........<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1888241-1888168)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (1888207-1888205)	Score: 91.79
Seq: GGGCCTATAGCTCAGCTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGATGGTTCAAGTCCATTTAGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna20 (1882726-1882653)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (1882692-1882690)	Score: 91.79
Seq: GGGCCTATAGCTCAGCTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGATGGTTCAAGTCCATTTAGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna37 (1679687-1679614)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (1679653-1679651)	Score: 91.79
Seq: GGGCCTATAGCTCAGCTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGATGGTTCAAGTCCATTTAGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna64 (1665238-1665165)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (1665204-1665202)	Score: 91.79
Seq: GGGCCTATAGCTCAGCTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGATGGTTCAAGTCCATTTAGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna71 (1609384-1609296)	Length: 89 bp
Type: Leu	Anticodon: AAG at 34-36 (1609351-1609349)	Score: 62.75
Seq: GCGGGCGTGGCGGAATGGCaGACGCGCAAGACTAAGGATCTTGTGATCGCTTTTAGATCGTGGAAGTTCGAGTCTTCTCGCCCGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>.......<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna49 (1677431-1677348)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (1677397-1677395)	Score: 61.65
Seq: GGCGGTGTGGCGGAATTGGCaGACGCGTCAGACTCAAAATCTGGTGTCCCCTGGGACGTATCGGTTCGACCCCGATCACCGCTA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>..<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna72 (1554034-1553948)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (1554000-1553998)	Score: 58.98
Seq: GCCTCAATGGCGGAATTGGCaGACGCGCAGCGTTCAGGTCGCTGTTCACGCAAGTGAGTGCAGGTTCGACTCCTGTTTGAGGCACAA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (1680483-1680398)	Length: 86 bp
Type: Leu	Anticodon: TAA at 35-37 (1680449-1680447)	Score: 67.41
Seq: GCCGGGGTGGCGGAACTGGCaGACGCACGGGACTTAAAATCCCGCGGTTGGTGACAACCGTACCGGTTCGATTCCGGTCCTCGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna55 (1666034-1665949)	Length: 86 bp
Type: Leu	Anticodon: TAA at 35-37 (1666000-1665998)	Score: 67.41
Seq: GCCGGGGTGGCGGAACTGGCaGACGCACGGGACTTAAAATCCCGCGGTTGGTGACAACCGTACCGGTTCGATTCCGGTCCTCGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna25 (1680744-1680660)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (1680710-1680708)	Score: 69.44
Seq: GCGGGTGTGGCGGAATTGGCaGACGCGCTAGATTTAGGTTCTAGTGTTTTCGGACGTGTGGGTTCAAGTCCCACCACCCGTACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>..<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna52 (1666295-1666211)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (1666261-1666259)	Score: 69.44
Seq: GCGGGTGTGGCGGAATTGGCaGACGCGCTAGATTTAGGTTCTAGTGTTTTCGGACGTGTGGGTTCAAGTCCCACCACCCGTACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>..<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna78 (87689-87617)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (87656-87654)	Score: 84.99
Seq: GGGTGGTTAGCTCAGCTGGCAGAGCAACGGACTCTTAATCCGTGGGtCCAGGGTTCGATCCCCTGACCACCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna79 (86009-85937)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (85976-85974)	Score: 84.99
Seq: GGGTGGTTAGCTCAGCTGGCAGAGCAACGGACTCTTAATCCGTGGGtCCAGGGTTCGATCCCCTGACCACCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna24 (1680837-1680765)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (1680804-1680802)	Score: 84.26
Seq: GAGTCGTTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGAGGGtCGGCAGTTCGAGCCTGCCACGACTCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna51 (1666388-1666316)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (1666355-1666353)	Score: 84.26
Seq: GAGTCGTTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGAGGGtCGGCAGTTCGAGCCTGCCACGACTCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna31 (1680205-1680132)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1680171-1680169)	Score: 73.74
Seq: GGCGGTGTAGCTCAGCTGGCtAGAGCGTCCGGTTCATACCCGGGAGGtCGAGGGTTCGATCCCCCCCGCCGCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna58 (1665756-1665683)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1665722-1665720)	Score: 73.74
Seq: GGCGGTGTAGCTCAGCTGGCtAGAGCGTCCGGTTCATACCCGGGAGGtCGAGGGTTCGATCCCCCCCGCCGCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna33 (1680013-1679940)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1679979-1679977)	Score: 76.97
Seq: CGCGGGATGGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCATAGGTTCAAATCCTGTTCCCGCAA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr.trna60 (1665564-1665491)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1665530-1665528)	Score: 76.97
Seq: CGCGGGATGGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCATAGGTTCAAATCCTGTTCCCGCAA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr.trna41 (1678111-1678038)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1678077-1678075)	Score: 77.97
Seq: CGCGGGATGGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCATAGGTTCAAATCCTATTCCCGCAA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr.trna32 (1680118-1680045)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1680084-1680082)	Score: 89.60
Seq: GGACCTTTAGCTCAGTTGGTtAGAGCAGACGGCTCATAACCGTCGGGtCGTAGGTTCGAGTCCTACAAGGTCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna59 (1665669-1665596)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1665635-1665633)	Score: 89.60
Seq: GGACCTTTAGCTCAGTTGGTtAGAGCAGACGGCTCATAACCGTCGGGtCGTAGGTTCGAGTCCTACAAGGTCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna9 (341099-341172)	Length: 74 bp
Type: Phe	Anticodon: GAA at 34-36 (341132-341134)	Score: 52.20
Seq: GGCAACTTAGCTCAGTAGGTAGAGCGTTAGAGTGAAGTTCTAAGTcGtCGGTGGTTCGATCCCATCAGTTACCA
Str: >>.>>>>..>>>>........<<<<.>>>>>.......<<<<<......>>>>>.......<<<<<<<<<.<<.
                    
chr.trna35 (1679859-1679787)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (1679826-1679824)	Score: 77.44
Seq: GGCTCGATAGCTCAGTTGGTAGAGCAAAGGATTGAAGCTCCTTGTGtCGGCGGTTCGATTCCGTCTCGCGCCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr.trna43 (1677956-1677884)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (1677923-1677921)	Score: 77.44
Seq: GGCTCGATAGCTCAGTTGGTAGAGCAAAGGATTGAAGCTCCTTGTGtCGGCGGTTCGATTCCGTCTCGCGCCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr.trna62 (1665410-1665338)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (1665377-1665375)	Score: 77.44
Seq: GGCTCGATAGCTCAGTTGGTAGAGCAAAGGATTGAAGCTCCTTGTGtCGGCGGTTCGATTCCGTCTCGCGCCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr.trna5 (327710-327783)	Length: 74 bp
Type: Pro	Anticodon: CGG at 35-37 (327744-327746)	Score: 58.48
Seq: CGGGATGTGGCTCAGCTtGGTAGAGCGCTACGTTCGGGACGTAGAAGtCGCAGGTTCAAATCCTGTACTCTCCT
Str: .>>>>....>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<..<<<<..
                    
chr.trna30 (1680309-1680236)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (1680275-1680273)	Score: 87.66
Seq: CGGGAAGTGGCTCAGTTtGGTAGAGCACCTGGTTTGGGACCAGGGGGtCGCAGGTTCGAATCCTGTCTTCCCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna57 (1665860-1665787)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (1665826-1665824)	Score: 87.66
Seq: CGGGAAGTGGCTCAGTTtGGTAGAGCACCTGGTTTGGGACCAGGGGGtCGCAGGTTCGAATCCTGTCTTCCCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna76 (775903-775832)	Length: 72 bp
Type: Arg	Anticodon: CCG at 34-36 (775870-775868)	Score: 32.37
Seq: GTGCCCTTAGTGTAATGGAtCGCACGTAAGATTCCGGTTCTTAAAATCTGAGTTCGACTCTCAGGGGGCGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna74 (1330556-1330469)	Length: 88 bp
Type: Ser	Anticodon: CGA at 33-35 (1330524-1330522)	Score: 73.06
Seq: GGAGAGTTGGCAGAGTGGTAATGCACCGGACTCGAAATCCGGCGAACCGGCTTAtACCGGCGCGCAGGTTCAAATCCTGTACTCTCCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>......<<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna38 (1679611-1679522)	Length: 90 bp
Type: Ser	Anticodon: GCT at 35-37 (1679577-1679575)	Score: 56.58
Seq: GGAGATTTACTCAAGTGGCtgAAGAGGCGCCCCTGCTAAGGGTGTAGGTCGGTTTAtACCGGCGCGAGGGTTCGAATCTCTCAATCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>>>>....<<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna65 (1665162-1665073)	Length: 90 bp
Type: Ser	Anticodon: GCT at 35-37 (1665128-1665126)	Score: 56.58
Seq: GGAGATTTACTCAAGTGGCtgAAGAGGCGCCCCTGCTAAGGGTGTAGGTCGGTTTAtACCGGCGCGAGGGTTCGAATCTCTCAATCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>>>>....<<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna11 (563561-563650)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (563595-563597)	Score: 55.38
Seq: GGAGTGTTGTCCGAGTGGCtgAAGGAGCATGATTGGAAATCATGTATACGGGCTTTaCCTGTATCGAGAGTTCGAATCTCTCACACTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>>.....<<<<<<<.>>>>>.......<<<<<<<<<<<<.
                    
chr.trna6 (340597-340667)	Length: 71 bp
Type: Ser	Anticodon: TGA at 33-35 (340629-340631)	Score: 40.16
Seq: AGGAGTGTAGCCAAATGGTACGGCATCGTGTTTGAGCCCGAGTTaTGTTGGTTCGAGTCCAGCCACTCCTA
Str: >>>>>>>..>>>.........<<<.>>>.>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna40 (1678209-1678119)	Length: 91 bp
Type: Ser	Anticodon: TGA at 37-39 (1678173-1678171)	Score: 55.88
Seq: GGAGGATTACCCAAGTCcGGCtgAAGGGAACGGTCTTGAAAACCGTCAGGCGGGTTCTGCCCGCGCGTGGGTCCGAATCCCACATCCTCCT
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<...>>>>>>...<<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna1 (19503-19578)	Length: 76 bp
Type: Thr	Anticodon: AGT at 34-36 (19536-19538)	Score: 82.73
Seq: GCTGACTTAGCTCAGTTGGCAGAGCACGTCACTAGTAATGATGAGGtCGAAGGTTCGAATCCTTTAGTCAGCACTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna2 (21315-21390)	Length: 76 bp
Type: Thr	Anticodon: AGT at 34-36 (21348-21350)	Score: 82.73
Seq: GCTGACTTAGCTCAGTTGGCAGAGCACGTCACTAGTAATGATGAGGtCGAAGGTTCGAATCCTTTAGTCAGCACAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna67 (1643839-1643767)	Length: 73 bp
Type: Thr	Anticodon: CGT at 34-36 (1643806-1643804)	Score: 78.85
Seq: GCTGAATTAGCTCAGTTGGTAGAGCGCTTCCCTCGTAAAGAAGAGGtCGCCAGTTCGATCCTGGCATTCAGCA
Str: >>>>>>>..>>>>........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna3 (209038-209110)	Length: 73 bp
Type: Thr	Anticodon: GGT at 34-36 (209071-209073)	Score: 63.60
Seq: GCCGTTTTAGCTCAGGAGGTAGAGCACCGCCGTGGTAAGGAGGAGGtCCCCAGTTCAAATCTGGGAAACGGCT
Str: >>>>>>>..>>>>........<<<<.>>.>>.......<<.<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna26 (1680658-1680586)	Length: 73 bp
Type: Thr	Anticodon: TGT at 34-36 (1680625-1680623)	Score: 88.52
Seq: GCCGATTTAGCTCAGTTGGTAGAGCATCTGTCTTGTAAACAGGGGGtCGAAGGTTCGAGTCCTTTAATCGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna53 (1666209-1666137)	Length: 73 bp
Type: Thr	Anticodon: TGT at 34-36 (1666176-1666174)	Score: 88.52
Seq: GCCGATTTAGCTCAGTTGGTAGAGCATCTGTCTTGTAAACAGGGGGtCGAAGGTTCGAGTCCTTTAATCGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna45 (1677790-1677720)	Length: 71 bp
Type: Trp	Anticodon: CCA at 33-35 (1677758-1677756)	Score: 45.48
Seq: AGGGATATCGTATAAAGGTAGTACATCGGTCTCCAAAACCGCTAGTGTGGGTTCAATTCCTACTATCCCTG
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna8 (340937-341018)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 34-36 (340970-340972)	Score: 46.08
Seq: GGCAAAGTGGTCCAGTAGCaACGACAGCGGACTGTAAATCCGCCACCGAAAGGTTaCGTAGGTGCGAGTCCTACCTTTGCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna44 (1677879-1677798)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 35-37 (1677845-1677843)	Score: 64.08
Seq: GGAGGCCTAGCGAAGTGGCtaAACGCGGCGGTCTGTAAAACCGCTCTCTCTGAGTtCGGTGGTTCGAATCCACTGGCCTCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna69 (1631500-1631419)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 35-37 (1631466-1631464)	Score: 64.08
Seq: GGAGGCCTAGCGAAGTGGCtaAACGCGGCGGTCTGTAAAACCGCTCTCTCTGAGTtCGGTGGTTCGAATCCACTGGCCTCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna13 (563864-563936)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (563897-563899)	Score: 86.40
Seq: GGAGGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGGAGGtCACAGGTTCGAGCCCTGTATCCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna23 (1680912-1680840)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1680879-1680877)	Score: 86.40
Seq: GGAGGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGGAGGtCACAGGTTCGAGCCCTGTATCCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna50 (1666463-1666391)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1666430-1666428)	Score: 86.40
Seq: GGAGGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGGAGGtCACAGGTTCGAGCCCTGTATCCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.