GtRNAdb

tRNAscan-SE Analysis of Ochrobactrum anthropi ATCC 49188

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr1.trna1 (34671-34746)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (34704-34706)	Score: 87.70
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGtCAGCGGTTCGATCCCGCTTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna10 (1348088-1348163)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (1348121-1348123)	Score: 90.94
Seq: GGGGCCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr1.trna6 (1085865-1085940)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (1085898-1085900)	Score: 90.94
Seq: GGGGCCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr2.trna3 (458670-458745)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (458703-458705)	Score: 90.94
Seq: GGGGCCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr2.trna9 (1601722-1601647)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (1601689-1601687)	Score: 90.94
Seq: GGGGCCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGtCGTCGGTTCGATCCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
chr1.trna41 (353572-353496)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (353538-353536)	Score: 91.80
Seq: GCACCCGTAGCTCAGCTGGAtAGAGCACCAGACTACGAATCTGGGGGtCAGAGGTTCGAATCCTTTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna28 (2334000-2333924)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (2333966-2333964)	Score: 90.32
Seq: GCACCCGTAGCTCAGCTGGAtAGAGTGCTGCCCTCCGAAGGCAGAGGtCACAGGTTCGAATCCTGTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna40 (935397-935321)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (935363-935361)	Score: 88.11
Seq: GGTCCCGTAGCTCAGTAGGAtAGAGCGACAGATTCCTAATCTGTAGGtCACAGGTTCGATTCCTGTCGGGATCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna21 (2697314-2697238)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (2697280-2697278)	Score: 90.68
Seq: GGTCCCGTAGCTCAGTTGGAtAGAGCGTCAGCCTTCTAAGCTGAATGtCACAGGTTCGAATCCTGTCGGGATCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna12 (1082209-1082135)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (1082177-1082175)	Score: 89.56
Seq: TCCCCGGTAGCTCAGCGGTAGAGCAACCGGCTGTTAACCGGTTGGtCGCTGGTTCGAATCCGGCCCGGGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna23 (2551010-2550934)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2550976-2550974)	Score: 92.83
Seq: GCGGGTGTAGCTCAGTTGGTtAGAGTGCCGGCCTGTCACGCCGGAGGtCGCGGGTTCGAGCCCCGTCACTCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna24 (2550688-2550612)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2550654-2550652)	Score: 92.83
Seq: GCGGGTGTAGCTCAGTTGGTtAGAGTGCCGGCCTGTCACGCCGGAGGtCGCGGGTTCGAGCCCCGTCACTCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna5 (1068874-1068947)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1068906-1068908)	Score: 66.24
Seq: GGCCTCGTGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACCCCGGTTCGATTCCGGGCGAGGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna16 (299796-299723)	Length: 74 bp
Type: Gln	Anticodon: CTG at 33-35 (299764-299762)	Score: 67.13
Seq: TGGGGAATAGTTTAAGGGTAGAACAGCGGACTCTGACTCCGCTAGTCTTGGTTCGAATCCAGGTTCCCCAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna4 (726699-726773)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (726731-726733)	Score: 74.48
Seq: TGGGGCGTAGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGCCATtCCCTGGTTCGAATCCAGGCGCCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna8 (1312035-1312109)	Length: 75 bp
Type: Glu	Anticodon: CTC at 34-36 (1312068-1312070)	Score: 65.98
Seq: GCGCCCATCGTCTAGCGGTcAGGACGGCGCCCTCTCACGGCGCAAACAGGGGTTCGATTCCCCTTGGGCGTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna31 (2015496-2015422)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2015463-2015461)	Score: 71.93
Seq: GCGCCCATCGTCTAGCGGTtAGGACAGCGCCCTTTCACGGCGCAGACAGGGGTTCGATTCCCCTTGGGCGTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna32 (2015275-2015201)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2015242-2015240)	Score: 71.93
Seq: GCGCCCATCGTCTAGCGGTtAGGACAGCGCCCTTTCACGGCGCAGACAGGGGTTCGATTCCCCTTGGGCGTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna30 (2168760-2168687)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (2168728-2168726)	Score: 65.12
Seq: GCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCTGAACGCGCGGGTTCGATTCCCGCTACCCGCTCCA
Str: >>>>>>>..>.>>.......<<.<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna37 (1355764-1355690)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (1355732-1355730)	Score: 88.17
Seq: GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGAGGGTTCGAATCCCTTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna15 (611905-611831)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (611873-611871)	Score: 88.17
Seq: GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGAGGGTTCGAATCCCTTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna14 (2040654-2040727)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (2040686-2040688)	Score: 83.28
Seq: GCGGGTATAGCTCAATGGTAGAGCAGCAGCCTTCCAAGCTGAATACGCGGGTTCGATTCCCGCTACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna11 (1333873-1333797)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (1333839-1333837)	Score: 86.57
Seq: GCGGTCGTAGCTCAGTTGGTtAGAGCGCAGGATTGTGGCTCCTGAGGtCGTTGGTTCAACTCCAACCGACCGTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna5 (1085777-1085853)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (1085811-1085813)	Score: 99.09
Seq: GGGCTTGTAGCTCAGTTGGTtAGAGCACACGCTTGATAAGCGTGGGGtCGGAGGTTCAAGTCCTCCCAGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna9 (1348000-1348076)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (1348034-1348036)	Score: 99.09
Seq: GGGCTTGTAGCTCAGTTGGTtAGAGCACACGCTTGATAAGCGTGGGGtCGGAGGTTCAAGTCCTCCCAGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna2 (458582-458658)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (458616-458618)	Score: 99.09
Seq: GGGCTTGTAGCTCAGTTGGTtAGAGCACACGCTTGATAAGCGTGGGGtCGGAGGTTCAAGTCCTCCCAGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna8 (1601810-1601734)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (1601776-1601774)	Score: 99.09
Seq: GGGCTTGTAGCTCAGTTGGTtAGAGCACACGCTTGATAAGCGTGGGGtCGGAGGTTCAAGTCCTCCCAGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna39 (1051311-1051227)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (1051277-1051275)	Score: 76.80
Seq: GCGGGTGTGGTGGAACTGGTaGACGCGCCGGACTCAAAATCCGGTTCCGAAAGGAGTGTCGGTTCGATTCCGACCACCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna35 (1406085-1405999)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (1406051-1406049)	Score: 78.71
Seq: GCCCAGATGGCGGAATTGGTaGACGCACCAGCTTCAGGTGCTGGCGCTCGCAAGGGCGTGGAGGTTCGAGTCCTCTTCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna16 (2269141-2269225)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (2269175-2269177)	Score: 70.40
Seq: GCGGTCGTGGCGGAATTGGTaGACGCGCAGCGTTGAGGTCGCTGTGGGGCAACCCGTGGAAGTTCGAGTCTTCTCGACCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna29 (2245248-2245163)	Length: 86 bp
Type: Leu	Anticodon: TAA at 35-37 (2245214-2245212)	Score: 75.57
Seq: GCGGTCGTGGCGAAATTGGTaTACGCAACGGACTTAAAATCCGTCGTCTTTTAGACTTGCGGGTTCAAGTCCCGCCGACCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna25 (2451550-2451468)	Length: 83 bp
Type: Leu	Anticodon: TAG at 35-37 (2451516-2451514)	Score: 74.64
Seq: GCGGATGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGGGAGACCGTGGGGGTTCGAGTCCCTCCATCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna33 (1947171-1947096)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (1947138-1947136)	Score: 96.09
Seq: GGGTGATTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGtCGTAGGTTCGATCCCTACATCACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna13 (1033629-1033554)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (1033596-1033594)	Score: 95.04
Seq: GAGCGCGTAGCTCAGCCGGTAGAGCAACTGACTTTTAATCAGTAGGtCCAGGGTTCGAATCCCTGCGCGCTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna11 (1351704-1351780)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1351738-1351740)	Score: 81.76
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGcCGCAGGTTCAAATCCTGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr1.trna7 (1089481-1089557)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1089515-1089517)	Score: 81.76
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGcCGCAGGTTCAAATCCTGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr2.trna10 (1598106-1598030)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1598072-1598070)	Score: 81.76
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGcCGCAGGTTCAAATCCTGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr2.trna4 (462286-462362)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (462320-462322)	Score: 81.76
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGcCGCAGGTTCAAATCCTGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr1.trna26 (2443519-2443445)	Length: 75 bp
Type: Met	Anticodon: CAT at 33-35 (2443487-2443485)	Score: 83.82
Seq: CGCAGGATAGAGCAGCGGTAGCTCAGTTGGTTCATACCCAACAGGtCGCGGGTTCGAATCCCGCTCCTGCAACCA
Str: .>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr1.trna34 (1640322-1640246)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1640288-1640286)	Score: 86.65
Seq: GGCGGAGTAGCTCAGTAGGTtAGAGCAGAGGAATCATAATCCTTGTGtCGGGGGTTCGAATCCCTCCTCCGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna12 (1779957-1780033)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1779991-1779993)	Score: 87.64
Seq: GGGCCTGTAGCTCAATTGGTtAGAGCCGGCGGCTCATAACCGCTTGGtTGGGGGTTCGAGTCCCTCCGGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna42 (338431-338356)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (338398-338396)	Score: 93.28
Seq: GCCCGGATAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGtCGGTGGTTCGAATCCGCCTCCGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna2 (224559-224635)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (224593-224595)	Score: 86.87
Seq: CGGAGTGTAGCGCAGCCtGGTAGCGCACCTCGTTCGGGACGAGGGGGtCGGAGGTTCAAATCCTCTCACTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna18 (2641458-2641534)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (2641492-2641494)	Score: 81.90
Seq: CGGAGCGTAGCGCAGCCcGGTAGCGCACTTGACTGGGGGTCAAGGGGtCGTGGGTTCGAATCCCGCCGCTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna20 (2697976-2697900)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (2697942-2697940)	Score: 93.11
Seq: CGGAGCGTAGCGCAGTCtGGTAGCGCACCTGATTTGGGATCAGGGGGtCGCAGGTTCGAATCCTGCCGCTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna1 (151860-151951)	Length: 92 bp
Type: SeC(p)	Anticodon: TCA at 35-37 (151894-151896)	Score: 45.68
Seq: GGAAGGGATGCATGCCCGGTGGCATGTCCGGACTTCAAATCCGGGAGGGGCCGAtAGACGGTCTTTGGTGGGTTCGACTCCCATTCTCTTCC
Str: >>>>>>>>..>>>>>>....<<<<<<>>>>>>.......<<<<<<>>>>>>>>.....<<<<<<<<.>>>>>.......<<<<<<<<<<<<<
                    
chr1.trna38 (1097009-1096920)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (1096975-1096973)	Score: 78.59
Seq: GGAGAGGTGGCTGAGTGGTcgAAAGTACCGCACTCGAAATGCGGCGTGGGGGTAACTCCACCGTGGGTTCGAATCCCACCCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna19 (2773282-2773372)	Length: 91 bp
Type: Ser	Anticodon: GCT at 35-37 (2773316-2773318)	Score: 72.54
Seq: GGAGAGGTGGCCGAGTGGTcgAAGGCGCTCCCCTGCTAAGGGAGTAGACCTCATAAGGGTCTCGTGGGTTCGAATCCCATCCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>.....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna36 (1388891-1388802)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (1388857-1388855)	Score: 77.71
Seq: GGAGAGGTGGCCGAGTGGTtgAAGGCGCACGCCTGGAACGCGTGTATACGGGAAACCGTATCGAGGGTTCGAATCCCTCTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna14 (992306-992217)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (992272-992270)	Score: 80.78
Seq: GGAGGGGTGGCCGAGCGGTttAAGGCACCGGTCTTGAAAACCGGCGTGCGGGAGACTGTACCGTGGGTTCGAATCCCACCCCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna6 (1474675-1474750)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (1474708-1474710)	Score: 92.11
Seq: GCCGCTTTAGCTCAGTTGGTAGAGCACATCATTCGTAATGATGGGGtCAGGTGTTCGAGTCACCTAAGCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna3 (344746-344820)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (344778-344780)	Score: 86.73
Seq: GCTGCGGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGtCGAGAGTTCAATCCTCTCTCGCAGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna17 (2370594-2370669)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (2370627-2370629)	Score: 94.13
Seq: GCCCTTATAGCTCAGTTGGTAGAGCACCTGATTTGTAATCAGGGGGtCGGGAGTTCGAGTCTCTCTGGGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna15 (2042108-2042183)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (2042141-2042143)	Score: 88.85
Seq: AGGGGTATAGCTCAGTTGGTAGAGCGACGGTCTCCAAAACCGTAGGtCGCGGGTTCGAGCCCTGCTGCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna13 (2040545-2040629)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (2040579-2040581)	Score: 73.28
Seq: GGAGGGATGCCCGAGTGGTtaAAGGGGACGGACTGTAAATCCGTTGGCTATGCCTaCGTTGGTTCAAATCCAACTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>><<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna27 (2342239-2342165)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (2342207-2342205)	Score: 88.54
Seq: GGGCGTGTAGCTCAGCGGGAGAGCACTCCCTTCACACGGGAGGGGtCACAGGTTCAATCCCTGTCACGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr2.trna7 (1720645-1720719)	Length: 75 bp
Type: Val	Anticodon: GAC at 33-35 (1720677-1720679)	Score: 86.72
Seq: GGGCGTGTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGtCACAGGTTCAATCCCTGTCACGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr1.trna22 (2606808-2606733)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (2606775-2606773)	Score: 92.99
Seq: GGGCGATTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGtCGGGAGTTCGAGTCTCTCATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.