GtRNAdb

tRNAscan-SE Analysis of Prochlorococcus marinus NATL1A

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna21 (1365265-1365193)	Length: 73 bp
Type: Ala	Anticodon: GGC at 34-36 (1365232-1365230)	Score: 85.56
Seq: GGGGCCATAGCTCAGCTGGTAGAGCACCTGCATGGCATGCAGGGGGtCAGCGGTTCGAATCCGCTTGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna3 (387552-387624)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (387585-387587)	Score: 90.94
Seq: GGGGGTATAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGtCAGCGGTTCGAGTCCGCTTACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna36 (311928-311855)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (311894-311892)	Score: 76.73
Seq: GCGCCTGTAGCTCAGCGGAttAGAGCATCTGACTACGGATCAGAGGGtCGGGAGTTCGAATCTCTCCAGGCGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna14 (1662952-1663025)	Length: 74 bp
Type: Arg	Anticodon: CCG at 35-37 (1662986-1662988)	Score: 76.42
Seq: GGGCATGTAGCTCAGTTGGAtAGAGCATCAGATTCCGGTTCTGAGAGtCGGGGGTTCGAGTCCCTCCATGCTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna18 (1698617-1698544)	Length: 74 bp
Type: Arg	Anticodon: CCT at 35-37 (1698583-1698581)	Score: 86.39
Seq: GGGGCTGTAGCTCAGTTGGAtAGAGCGACGGTTTCCTAAACCGTAGGtCGTGGGTTCAAGTCCCGCCAGCCCCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna8 (1362133-1362206)	Length: 74 bp
Type: Arg	Anticodon: TCT at 35-37 (1362167-1362169)	Score: 82.72
Seq: GCTCCCTTAGCTCAGCTGGAtAGAGCAACTGCCTTCTAAGCAGTGGGcCGCTGGTTCGAATCCAGCAGGGAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna1 (184995-185066)	Length: 72 bp
Type: Asn	Anticodon: GTT at 33-35 (185027-185029)	Score: 75.77
Seq: TCCTCGGTAGCTCAGCGGTAGAGCGATCGGCTGTTAACCGATTGGtCGCAGGTTCGAATCCCGCCCGGGGAG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<.
                    
chr.trna30 (481527-481454)	Length: 74 bp
Type: Asp	Anticodon: GTC at 35-37 (481493-481491)	Score: 79.78
Seq: GGGACCGTAGTTCAACTGGTtAGAGCACCGCCCTGTCACGGCGGAAGtTGCGGGTTCGAATCCCGTCGGTCCCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna15 (1678924-1678994)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (1678956-1678958)	Score: 67.72
Seq: GGCGGCATGGCCAAGTGGTAAGGCAGAGGATTGCAAATCCTTTAtCCCCAGTTCGAATCTGGGTGCCGCCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna13 (1649641-1649712)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (1649673-1649675)	Score: 59.92
Seq: TGGGCCGTCGCCAAGTGGTAAGGCATCGGGTTTTGGTCTCGACATtCCTAGGTTCGAATCCTAGCGGCCCAG
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna7 (1220978-1221050)	Length: 73 bp
Type: Glu	Anticodon: TTC at 35-37 (1221012-1221014)	Score: 58.12
Seq: GGCCCCATCGTCTAGAGGCctAGGACACCTCCCTTTCACGGAGGCGACAGGGGTTCGAATCCCCTTGGGGCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna6 (1092399-1092470)	Length: 72 bp
Type: Gly	Anticodon: CCC at 33-35 (1092431-1092433)	Score: 77.41
Seq: GCGGGTGTAGTTCAGTGGTAGAACGTCAGCTTCCCAAGCTGAATGtCGCCAGTTCGAGTCTGGTCATCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna17 (1765110-1765039)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (1765078-1765076)	Score: 82.15
Seq: GCGGATGTAGCTCAGTGGTAGAGCATCTCCTTGCCAAGGAGAATGtCGAGAGTTCGAATCTCTTCATCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna20 (1431955-1431885)	Length: 71 bp
Type: Gly	Anticodon: TCC at 33-35 (1431923-1431921)	Score: 70.16
Seq: GCGGGCGTAGTTTAGTGGTAAAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCCGCCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna10 (1411489-1411561)	Length: 73 bp
Type: His	Anticodon: GTG at 34-36 (1411522-1411524)	Score: 60.30
Seq: GCGGGTGTCGCCAAGTGGTtAAGGCAGCGGCTTGTGGTGCCGCCATcCGGGGGTTCGAATCCCCTCATCCGCC
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna2 (387469-387542)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (387503-387505)	Score: 86.10
Seq: GGGCCATTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCCCTGGTTCAAGTCCAGGATGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna38 (121822-121741)	Length: 82 bp
Type: Leu	Anticodon: AAG at 35-37 (121788-121786)	Score: 62.62
Seq: GCGGATGTGGCGGAATTGGTaTACGCGCATGTCTAAGGAACATGTGGCTTCGGCCtTGCGAGTTCAAGTCTCGCCATCCGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>..<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna9 (1406107-1406188)	Length: 82 bp
Type: Leu	Anticodon: CAA at 35-37 (1406141-1406143)	Score: 63.26
Seq: GGGAGCGTGGTGGAATTGGTaGACGCACCGCACTCAAAATGCGGCACCTTCGGGTtTGTCGGTTCAAGTCCGACCGCTCCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>..<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna28 (569480-569395)	Length: 86 bp
Type: Leu	Anticodon: TAA at 35-37 (569446-569444)	Score: 64.31
Seq: GCCAGCGTGGTGGAATTGGTaGACACACAGGACTTAAAATCCTGAGATCCGCAAGGGTCGTACGAGTTCAAGTCTCGTCGCTGGTA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna37 (293016-292934)	Length: 83 bp
Type: Leu	Anticodon: TAG at 35-37 (292982-292980)	Score: 58.51
Seq: GCCCACCTGGCGGAATTGGTaGACGCGCTGGTTTTAGGTACCAGTGGCTTTATGTCGTGGGAGTTCAAGTCTCCCGGTGGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>....<.<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna23 (1173589-1173518)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (1173557-1173555)	Score: 76.69
Seq: GGGTCGCTAGCTCAGTGGTAGAGCATCCGGCTTTTAACCGGCTGGtCCTGAGTTCGAATCTCAGGCGACCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr.trna35 (327593-327521)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (327560-327558)	Score: 44.16
Seq: GGGGGTGTAGCAATCTGGTgAATGCAGCGAACTCATAATTCGCCTTaGGCGAGTTCGATCCTCGCCACCCCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna5 (951623-951696)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (951657-951659)	Score: 75.73
Seq: GTCAGTGTAGCTCAGCCGGTtAGAGCACAGCATTCATAACGCTGAGGtCGAGAGTTCAAGTCTCTCCACTGACA
Str: >>>>>>>..>>>>.........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna26 (825992-825916)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (825958-825956)	Score: 85.08
Seq: CGCGGGGTAGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGCAAGTTCAAATCTTGCCCCCGCCACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna34 (367504-367429)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (367471-367469)	Score: 85.68
Seq: GCCGGGATAGCTCAGTTGGTAGAGCAGGCGACTGAAAATCGCCGTGtCCCCAGTTCAAATCTGGGTCCTGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (851079-851006)	Length: 74 bp
Type: Pro	Anticodon: GGG at 35-37 (851045-851043)	Score: 73.90
Seq: CGGGACGTAGCGCAGTTtGGTAGCGCACCACTTTGGGGTAGTGGGGGtCGTGGGTTCAAATCCCGCCGTTCCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna24 (1164326-1164250)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (1164292-1164290)	Score: 81.28
Seq: CGGGGCGTGGCGCAGCTtGGTAGCGCGGGTGCTTTGGGAGCACTAGGtCGCAGGTTCGAATCCTGTCGCCCCGATCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna22 (1322087-1322001)	Length: 87 bp
Type: Ser	Anticodon: CGA at 35-37 (1322053-1322051)	Score: 68.66
Seq: GGAGAGGTGGCTGAGTGGTcgAAAGCGAACGACTCGAAATCGTTTGATAGCTAAAACTATCCGTGGGTTCGAATCCCACCCTCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>......<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna19 (1629234-1629146)	Length: 89 bp
Type: Ser	Anticodon: GCT at 35-37 (1629200-1629198)	Score: 72.89
Seq: GGAGAGGTGGCTGAGTGGTtgAAAGCGGCTCCCTGCTAAGGAGTTAcAGGAGGTAACTTCTGtCGAGGGTTCGAATCCCTCCCTCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>>>....<<<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna4 (900647-900733)	Length: 87 bp
Type: Ser	Anticodon: GGA at 35-37 (900681-900683)	Score: 69.01
Seq: GGAGAGGTGGCCGAGTGGTtgAAGGCGCAGCACTGGAAATGCTGTATAGGGGCAACCCTATCGAGGGTTCGAATCCCTCTCTCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<.
                    
chr.trna27 (659854-659768)	Length: 87 bp
Type: Ser	Anticodon: TGA at 35-37 (659820-659818)	Score: 58.25
Seq: GGAGAGTTGGTCGAGTGGTttATGGCTCTAGTCTTGAAAACTAGCATGGGGGCAACTCCATCGGGGGTTCGAATCCCCCACTCTCCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<.
                    
chr.trna12 (1560860-1560931)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (1560892-1560894)	Score: 74.91
Seq: GCCGGTGTAGCTCAGGGGTAGAGCAACTGATTCGTAACCAGTAGGtCGGTGGTTCAATTCCACTCATCGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna32 (402240-402169)	Length: 72 bp
Type: Thr	Anticodon: GGT at 33-35 (402208-402206)	Score: 79.28
Seq: GCCCTTGTAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGtCTCGGGTTCAAGTCCCGACGAGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna33 (377781-377710)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (377749-377747)	Score: 74.01
Seq: GCCGGCTTAGCTCAGCGGTAGAGCAGCGCTTTTGTAAAGCGAAGGtCATCAGTTCAAATCTGTTAGCCGGCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<......>.>>>.......<<<.<<<<<<<<.
                    
chr.trna29 (482026-481954)	Length: 73 bp
Type: Trp	Anticodon: CCA at 34-36 (481993-481991)	Score: 81.69
Seq: GCGCCGTTAGTTCAGTTGGTAGAACGCAGGTCTCCAAAACCTGATGtCGGGGGTTCAAGTCCTCCACGGCGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna31 (402333-402252)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 35-37 (402299-402297)	Score: 54.03
Seq: GGGTCGGTGCCCGAGTGGTtaATGGGGGCGGACTGTAAATCCGCTGGCTACGCCTaCGTTGGTTCAAATCCAACCCGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna11 (1464793-1464864)	Length: 72 bp
Type: Val	Anticodon: GAC at 33-35 (1464825-1464827)	Score: 81.66
Seq: GGGCGATTAGCTCAGAGGTAGAGCACTACCTTGACACGGTAGGGGtCACTGGTTCGATTCCAGTATCGCCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna16 (1814007-1813936)	Length: 72 bp
Type: Val	Anticodon: TAC at 33-35 (1813975-1813973)	Score: 81.28
Seq: GGGCGATTAGCTCAGCGGTAGAGCGCCTGCCTTACAAGCAGGATGtCCCTGGTTCGAACCCTGGATCGCCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.