GtRNAdb

tRNAscan-SE Analysis of Populus trichocarpa (Jan 2010 Version 2.0)

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


scaffold_1.trna42 (44658543-44658615)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (44658576-44658578)	Score: 65.95
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna14 (16262498-16262570)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (16262531-16262533)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna2 (1353435-1353507)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (1353468-1353470)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna1 (621372-621444)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (621405-621407)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna36 (32919558-32919630)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (32919591-32919593)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna4 (3684846-3684918)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (3684879-3684881)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1463.trna1 (3215-3143)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (3182-3180)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna10 (11983916-11983988)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (11983949-11983951)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna6 (3627865-3627937)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (3627898-3627900)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna9 (11966682-11966754)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (11966715-11966717)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna7 (11103204-11103276)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (11103237-11103239)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna10 (13497750-13497822)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (13497783-13497785)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna11 (13677762-13677834)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (13677795-13677797)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna17 (19687627-19687699)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (19687660-19687662)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna33 (10892938-10892866)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (10892905-10892903)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna1 (1249384-1249456)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (1249417-1249419)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna42 (5539113-5539041)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (5539080-5539078)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna41 (3288745-3288673)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (3288712-3288710)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna15 (3960410-3960338)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (3960377-3960375)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna21 (1609853-1609781)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (1609820-1609818)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna8 (8310118-8310190)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (8310151-8310153)	Score: 63.43
Seq: GGGGTTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCAGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna12 (14251878-14251950)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (14251911-14251913)	Score: 63.43
Seq: GGGGTTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCAGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna6 (7015659-7015731)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (7015692-7015694)	Score: 64.52
Seq: GGGGATGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna2 (1790105-1790177)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (1790138-1790140)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna23 (1027306-1027234)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (1027273-1027271)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna4 (2873939-2874011)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (2873972-2873974)	Score: 37.48
Seq: GGGGACGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAAGGTTAGATCCCCTGCATTCTAT
Str: .>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<.<<<<..
                    
scaffold_5.trna5 (2886990-2887064)	Length: 75 bp
Type: Ala	Anticodon: TGC at 32-34 (2887021-2887023)	Score: 44.86
Seq: AATTGGAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGcatcTCCAATTC
Str: >>>>>>>>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<....<<<<<<<.
                    
scaffold_6.trna40 (4736339-4736267)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (4736306-4736304)	Score: 61.98
Seq: GGGGATGTAGCTCAAATAGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna4 (1822301-1822373)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1822334-1822336)	Score: 63.76
Seq: GGGGATGTAGCACAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>.>........<.<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna22 (26738766-26738838)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (26738799-26738801)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna7 (8220116-8220188)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (8220149-8220151)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna59 (26420148-26420076)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (26420115-26420113)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna60 (26397104-26397032)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (26397071-26397069)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna5 (2651628-2651700)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (2651661-2651663)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna15 (14947688-14947760)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (14947721-14947723)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna32 (19681759-19681687)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (19681726-19681724)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna8 (6719088-6719160)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (6719121-6719123)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna7 (3114165-3114237)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (3114198-3114200)	Score: 69.90
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna9 (13304312-13304240)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (13304279-13304277)	Score: 69.90
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna9 (3857057-3856985)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (3857024-3857022)	Score: 69.90
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna26 (15577685-15577613)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (15577652-15577650)	Score: 69.90
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna8 (2969575-2969647)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (2969608-2969610)	Score: 69.90
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna38 (6442912-6442840)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (6442879-6442877)	Score: 69.90
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAGGGTTCGATCCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna11 (9344128-9344055)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (9344094-9344092)	Score: 44.58
Seq: GGGCCTGTAGCTCAGAGGAttAGAGCACGTGGCTACGAACCATGGTGtCAAGGCTTCGAATCCCTCCTCGCCCA
Str: >>>>..>..>>>>.........<<<<.>>>>>.......<<<<<......>>>.........<<<.<..<<<<.
                    
scaffold_1.trna5 (4806412-4806484)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (4806445-4806447)	Score: 65.98
Seq: GACTCCATGGCCCAATGGAtAAGGTGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGTAGAGTCG
Str: >>>>>.>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_4.trna13 (14021493-14021565)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (14021526-14021528)	Score: 68.77
Seq: GACTCCGTGGTCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGCGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna2 (7273165-7273237)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (7273198-7273200)	Score: 73.66
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna13 (3435331-3435259)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (3435298-3435296)	Score: 73.66
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna19 (18606528-18606456)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (18606495-18606493)	Score: 73.66
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna11 (5297661-5297733)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (5297694-5297696)	Score: 73.66
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna19 (12927501-12927429)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (12927468-12927466)	Score: 73.66
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1584.trna1 (2339-2267)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (2306-2304)	Score: 74.06
Seq: GACTCCGTGGCCCAATGGAtAAGGCGCTGGTCTACGGAACCAGAGAtTCTGGGTTCGATCCCCAGCGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna37 (7094410-7094338)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (7094377-7094375)	Score: 75.05
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna27 (18702984-18702912)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (18702951-18702949)	Score: 58.09
Seq: GATCTCATAGCGGAGTGGAtATGGCGTTAGACTCCGGATATAAAGGtCGTGGGTTCGAATCCCACTGCTATCG
Str: >>>..>>..>>.>........<.<<.>>>.>.......<.<<<.....>>>>>.......<<<<<<<..<<<.
                    
scaffold_5.trna38 (6872357-6872285)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (6872324-6872322)	Score: 69.19
Seq: GATCGCGTGGCCTAATGGAtAAGGCGCTCGCCTCCGGAGCGGGAGAtTGTGGGTTCGAGTCCCATCGCGATCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna11 (6487142-6487070)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (6487109-6487107)	Score: 69.19
Seq: GATCGCGTGGCCTAATGGAtAAGGCGCTCGCCTCCGGAGCGGGAGAtTGTGGGTTCGAGTCCCATCGCGATCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna24 (25128034-25128106)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (25128067-25128069)	Score: 70.60
Seq: GATCGCGTGGCCTAATGGAtAAGGCGCTCGCCTCCGGAGCGGGAGAtTGTGGGTTCGAGTCCCACCGTGATCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna5 (3098721-3098793)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (3098754-3098756)	Score: 83.85
Seq: GATCGCATAGCGGAGTGGAtATCGCGTTAGACTCCGAATCTAAAGGtCGTGGGTTCGAATCCCACTGCGATCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna24 (10411205-10411133)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (10411172-10411170)	Score: 70.50
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCATAGGTTCGACCCCTATCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_15.trna17 (11057018-11056946)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (11056985-11056983)	Score: 70.50
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCATAGGTTCGACCCCTATCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_14.trna3 (2448670-2448742)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (2448703-2448705)	Score: 72.14
Seq: GCGTCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGTAGGTTCGACCCCTACCTGACGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_2.trna11 (9548520-9548592)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (9548553-9548555)	Score: 72.14
Seq: GCGTCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGTAGGTTCGACCCCTACCTGACGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_3.trna4 (6832837-6832909)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (6832870-6832872)	Score: 72.63
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_4.trna34 (15520312-15520240)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (15520279-15520277)	Score: 72.63
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_6.trna21 (23655026-23655098)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (23655059-23655061)	Score: 72.63
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_9.trna32 (9014679-9014607)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (9014646-9014644)	Score: 72.63
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_18.trna17 (1521986-1521914)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (1521953-1521951)	Score: 74.13
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCATAGGTTCGACCCCTATCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_2043.trna1 (305-233)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (272-270)	Score: 74.13
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCATAGGTTCGACCCCTATCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_6.trna27 (24993108-24993036)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (24993075-24993073)	Score: 74.13
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCATAGGTTCGACCCCTATCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
scaffold_4.trna24 (21707511-21707584)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (21707545-21707547)	Score: 81.86
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTCTGACTTCGGATCAGAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna24 (20495601-20495528)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (20495567-20495565)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna61 (25983040-25982967)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (25983006-25983004)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna30 (21894546-21894473)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (21894512-21894510)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna3 (4416838-4416911)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (4416872-4416874)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna1 (1280796-1280869)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (1280830-1280832)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna39 (6084641-6084568)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (6084607-6084605)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna12 (13966008-13965936)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (13965975-13965973)	Score: 64.86
Seq: GTACCCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGGCGAcTGTGGGTTCGAGTCCCACCGGGTATG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna35 (15419826-15419754)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (15419793-15419791)	Score: 66.30
Seq: GCGCCCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGGCGAcTGTGGGTTCGAGTCCCACCGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna34 (16807004-16806932)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (16806971-16806969)	Score: 66.30
Seq: GCGCCCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGGCGAcTGTGGGTTCGAGTCCCACCGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna5 (6125137-6125209)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (6125170-6125172)	Score: 66.30
Seq: GCGCCCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGGCGAcTGTGGGTTCGAGTCCCACCGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna33 (8914902-8914830)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (8914869-8914867)	Score: 67.95
Seq: GCGCCCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGGCGAcTGTGGGTTCGAATCCCACCGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna36 (6446603-6446531)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (6446570-6446568)	Score: 70.00
Seq: GCGCCCATGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGGCGAtTGTGGGTTCGAGTCCCACTGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna17 (11909359-11909431)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (11909392-11909394)	Score: 71.91
Seq: GCGCTCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGACGAtTGTGGGTTCGAGTCCCACCGAGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna35 (15144434-15144362)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (15144401-15144399)	Score: 71.91
Seq: GCGCTCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGACGAtTGTGGGTTCGAGTCCCACCGAGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna26 (10287476-10287404)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (10287443-10287441)	Score: 71.91
Seq: GCGCTCGTGGCCTAATGGAtAAGGCGTCTGACTTCTAATCAGACGAtTGTGGGTTCGAGTCCCACCGAGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna15 (15989652-15989724)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (15989685-15989687)	Score: 73.60
Seq: GCGCCCATGGCCTAATGGAtAAGGCGCTTGACTTCTAATCAAGCGAtTGTGGGTTCGAGTCCCACTGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna36 (5965770-5965698)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (5965737-5965735)	Score: 73.60
Seq: GCGCCCATGGCCTAATGGAtAAGGCGCTTGACTTCTAATCAAGCGAtTGTGGGTTCGAGTCCCACTGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna71 (6402557-6402486)	Length: 72 bp
Type: Asn	Anticodon: GTT at 33-35 (6402525-6402523)	Score: 59.72
Seq: TCCTCAGTAGCTCAGCGGTAGAGCGGTCGGCTGTTAACTGACTGGtCGTAGGTTCGCATCCTACTTGGAGAG
Str: >>.>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<.<<.
                    
scaffold_8.trna15 (15855422-15855493)	Length: 72 bp
Type: Asn	Anticodon: GTT at 33-35 (15855454-15855456)	Score: 60.64
Seq: TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTAGtCATAGGTTCAAATCCTACTTGGGGTA
Str: .>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<......>>>>.......<<<<.<<<<<<..
                    
scaffold_10.trna7 (12461326-12461399)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (12461360-12461362)	Score: 74.69
Seq: GCTGGAGTAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna18 (13450410-13450339)	Length: 72 bp
Type: Asn	Anticodon: GTT at 33-35 (13450378-13450376)	Score: 77.16
Seq: TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTGGtCGTAGGTTCGAATCCTACTTGGGGAG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna21 (5232465-5232392)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (5232431-5232429)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna6 (5063659-5063732)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (5063693-5063695)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna21 (19602473-19602546)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (19602507-19602509)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna16 (11438368-11438441)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (11438402-11438404)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna30 (8229337-8229264)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (8229303-8229301)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna34 (5899261-5899188)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (5899227-5899225)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna23 (11694503-11694576)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (11694537-11694539)	Score: 77.92
Seq: GCTGGAATAGCTCAGTTGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna16 (16304197-16304270)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (16304231-16304233)	Score: 78.10
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGAAGGTTCAAGCCCTTCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna18 (8203513-8203586)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (8203547-8203549)	Score: 78.10
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGAAGGTTCAAGCCCTTCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna28 (8830231-8830158)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (8830197-8830195)	Score: 80.45
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGAAGGTTCAACCCCTTCCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna9 (12144693-12144766)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (12144727-12144729)	Score: 81.02
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTATGGCTGTTAACCATAAGGtCGGAGGTTCGACCCCTTCCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna20 (9506357-9506430)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (9506391-9506393)	Score: 81.33
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGAAGGTTCAAGCCCTTCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna65 (15871614-15871541)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (15871580-15871578)	Score: 81.73
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGAAGGTTCAAGCCCTTCCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna5 (3322359-3322432)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (3322393-3322395)	Score: 81.83
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna12 (3661116-3661043)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (3661082-3661080)	Score: 81.83
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna14 (3288409-3288336)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (3288375-3288373)	Score: 81.83
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna8 (14339649-14339576)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (14339615-14339613)	Score: 81.83
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna11 (7381192-7381265)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (7381226-7381228)	Score: 81.83
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna19 (2224145-2224072)	Length: 74 bp
Type: Asp	Anticodon: GTC at 35-37 (2224111-2224109)	Score: 47.56
Seq: GGGATTGTAGTTTAATTGGTcAGAGCACCGCCCTGTCAAGGCGGAAGcTGCGGGTTCGAGCCTTGTCAGTCCCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna3 (2423844-2423915)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (2423877-2423879)	Score: 68.75
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAGCGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna3 (4310795-4310866)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (4310828-4310830)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna18 (13450534-13450463)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (13450501-13450499)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna4 (2961870-2961941)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (2961903-2961905)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna15 (13213566-13213495)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (13213533-13213531)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_249.trna1 (24540-24469)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (24507-24505)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna30 (13245160-13245089)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (13245127-13245125)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_335.trna1 (6487-6416)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (6454-6452)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna19 (22588291-22588362)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (22588324-22588326)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna4 (12652150-12652221)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (12652183-12652185)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna38 (3664562-3664491)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (3664529-3664527)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna10 (15392058-15392129)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (15392091-15392093)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna14 (17985437-17985508)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (17985470-17985472)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna2 (4310190-4310261)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (4310223-4310225)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna7 (5605492-5605563)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (5605525-5605527)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna8 (5608594-5608665)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (5608627-5608629)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1190.trna1 (4917-4988)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (4950-4952)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna19 (12247462-12247391)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (12247429-12247427)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna20 (12243779-12243708)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (12243746-12243744)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna46 (47608987-47608916)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (47608954-47608952)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna12 (7515716-7515645)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (7515683-7515681)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna2 (378459-378530)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (378492-378494)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna8 (10871193-10871264)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (10871226-10871228)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna1 (2407174-2407245)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (2407207-2407209)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna2 (2408305-2408376)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (2408338-2408340)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna7 (3555140-3555211)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (3555173-3555175)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna24 (25186999-25186928)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (25186966-25186964)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna25 (25181553-25181482)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (25181520-25181518)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna26 (25178720-25178649)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (25178687-25178685)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna31 (9670923-9670852)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (9670890-9670888)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna37 (6882524-6882453)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (6882491-6882489)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna32 (6013741-6013670)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (6013708-6013706)	Score: 70.78
Seq: GTCGTTGTAGTATAGTGGTgAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna32 (12735819-12735736)	Length: 84 bp
Type: Cys	Anticodon: ACA at 33-35 (12735787-12735785)	Score: 40.68
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGCCAAAACACGTGGAttgtCCTCGTGAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>.......<<<.....>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna38 (4483712-4483642)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (4483680-4483678)	Score: 27.57
Seq: ACCGACATAGCCGAGTGATAAGGCTGGGGACTGCAAATCCTTTTtTCCCAGTTCAAATTTGGATGTCGCCT
Str: ..>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>.......<<<<.<<<<<...
                    
scaffold_14.trna5 (5729930-5730000)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (5729962-5729964)	Score: 40.08
Seq: GGCTAGGTAACATAATGGAAATGTATCGGACTGCAAATCCTGGAATGACGGTTCGACCCCGTCCTTGGCCT
Str: >>>>>>>..>>>>.......<<<<.>.>>>.......<<<.<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna16 (20647615-20647686)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (20647647-20647649)	Score: 77.60
Seq: GGGTCCTTAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna23 (3029521-3029450)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (3029489-3029487)	Score: 77.60
Seq: GGGTCCTTAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna2 (4056770-4056841)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (4056802-4056804)	Score: 77.60
Seq: GGGTCCTTAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna44 (848533-848462)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (848501-848499)	Score: 77.60
Seq: GGGTCCTTAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna21 (1004642-1004571)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (1004610-1004608)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna17 (7603652-7603581)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (7603620-7603618)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna24 (13905702-13905631)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (13905670-13905668)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna31 (13201441-13201370)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (13201409-13201407)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna47 (1621963-1621892)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (1621931-1621929)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna31 (20483391-20483320)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (20483359-20483357)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna2 (3995947-3996018)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (3995979-3995981)	Score: 79.11
Seq: GGGTCCATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna13 (13048521-13048592)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (13048554-13048556)	Score: 68.64
Seq: GGTTCCATGGTCTAGTGGTaAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna2 (14359107-14359036)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (14359074-14359072)	Score: 69.12
Seq: GGTCCCATGGTCTAGTGGTaAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna24 (930915-930844)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (930882-930880)	Score: 69.79
Seq: GGTTCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAGTCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna13 (14301379-14301450)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (14301412-14301414)	Score: 69.79
Seq: GGTTCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAGTCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna76 (936472-936401)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (936439-936437)	Score: 70.59
Seq: GGTTCCATGGTCTAGCGGTtAGGACATTAGACTCTGAATCTAGTAACCCGAGTTCAATTCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna18 (16656442-16656513)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (16656475-16656477)	Score: 70.84
Seq: GGTCCCGTGGTCTAGTGGTgAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGCGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1840.trna1 (816-887)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (849-851)	Score: 71.44
Seq: GGTTCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna9 (8406630-8406701)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (8406663-8406665)	Score: 71.44
Seq: GGTTCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna14 (14372195-14372124)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (14372162-14372160)	Score: 71.93
Seq: GGTCCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna28 (20305030-20304959)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (20304997-20304995)	Score: 71.93
Seq: GGTCCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna4 (2660898-2660969)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (2660931-2660933)	Score: 71.93
Seq: GGTCCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna12 (11259568-11259639)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (11259601-11259603)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna41 (41452606-41452677)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (41452639-41452641)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna10 (11968951-11969022)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (11968984-11968986)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna37 (5845622-5845551)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (5845589-5845587)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna5 (5139792-5139863)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (5139825-5139827)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna24 (16101212-16101141)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (16101179-16101177)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna32 (17805552-17805481)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (17805519-17805517)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna19 (19067155-19067226)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (19067188-19067190)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna27 (19960880-19960809)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (19960847-19960845)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna28 (10650446-10650375)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (10650413-10650411)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_980.trna1 (6493-6422)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (6460-6458)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna22 (23860013-23860085)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (23860047-23860049)	Score: 69.44
Seq: TCCGTTGTAGTCTAGTTGGTcGGGATATTCGGCTCTCACCCGAAAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna8 (10945512-10945584)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (10945546-10945548)	Score: 72.20
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCAGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_30.trna2 (239731-239803)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (239765-239767)	Score: 74.68
Seq: TCCGTTGTTGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna23 (7828096-7828024)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (7828062-7828060)	Score: 75.25
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna29 (10911599-10911527)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (10911565-10911563)	Score: 77.21
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGCGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna20 (17294180-17294252)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (17294214-17294216)	Score: 77.21
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGCGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna8 (3876111-3876183)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (3876145-3876147)	Score: 77.21
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGCGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna6 (13829170-13829242)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (13829204-13829206)	Score: 77.21
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGCGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna42 (1785220-1785148)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (1785186-1785184)	Score: 77.31
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATATTCGGCTCTCACCCGAAAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna21 (23858823-23858895)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (23858857-23858859)	Score: 77.31
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATATTCGGCTCTCACCCGAAAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna22 (7841722-7841650)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (7841688-7841686)	Score: 77.70
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna14 (18578939-18579011)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (18578973-18578975)	Score: 77.70
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna15 (18593235-18593307)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (18593269-18593271)	Score: 77.70
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna12 (11364474-11364546)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (11364508-11364510)	Score: 77.70
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna14 (12743969-12744041)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (12744003-12744005)	Score: 77.70
Seq: TCCGTTGTAGTCTAGTTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna9 (6066855-6066927)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (6066889-6066891)	Score: 79.78
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna25 (28041055-28041127)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (28041089-28041091)	Score: 79.78
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna22 (4799358-4799286)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (4799324-4799322)	Score: 79.78
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna49 (41584652-41584580)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (41584618-41584616)	Score: 79.78
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna36 (8682774-8682702)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (8682740-8682738)	Score: 79.78
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna11 (7731936-7732008)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (7731970-7731972)	Score: 79.78
Seq: TCCGTTGTAGTCTAGTTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCAAGTCCCGGCAACGGAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna23 (27189029-27189100)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (27189062-27189064)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna3 (1006586-1006657)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1006619-1006621)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna9 (12131527-12131598)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (12131560-12131562)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna5 (10914526-10914597)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (10914559-10914561)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna40 (2021296-2021225)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (2021263-2021261)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna41 (1980654-1980583)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1980621-1980619)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_25.trna1 (176069-175998)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (176036-176034)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna18 (20042014-20042085)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (20042047-20042049)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna20 (23637792-23637863)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (23637825-23637827)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna3 (1625152-1625223)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1625185-1625187)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna32 (9339052-9338981)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (9339019-9339017)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna9 (12959007-12958936)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (12958974-12958972)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna29 (9740978-9740907)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (9740945-9740943)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna9 (7085481-7085552)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (7085514-7085516)	Score: 72.60
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna15 (16505234-16505304)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (16505266-16505268)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna21 (11788205-11788135)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (11788173-11788171)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna27 (2054956-2054886)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (2054924-2054922)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna19 (7163241-7163171)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (7163209-7163207)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna9 (9311859-9311929)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (9311891-9311893)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna2 (772652-772722)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (772684-772686)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_34.trna1 (150950-150880)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (150918-150916)	Score: 68.61
Seq: GCGCATCTAGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCGGGGTTCGATTCCCCGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna1 (15567962-15568032)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (15567994-15567996)	Score: 63.63
Seq: GCACCAGTGGTCTAGTGGTAGAATTGTACCCTGCCACGGTACAGACCCGGGTTCGATTACCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>.........<<<<<<<<<<<.
                    
scaffold_13.trna20 (2397302-2397232)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (2397270-2397268)	Score: 65.03
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTTGTGCA
Str: >>>>.>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_2311.trna1 (2957-2887)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (2925-2923)	Score: 68.86
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGACTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna10 (8312935-8313005)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (8312967-8312969)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna6 (5172218-5172288)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (5172250-5172252)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna10 (11030336-11030406)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (11030368-11030370)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna11 (11032436-11032506)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (11032468-11032470)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna28 (1904583-1904513)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (1904551-1904549)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna29 (1903770-1903700)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (1903738-1903736)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna30 (1902250-1902180)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (1902218-1902216)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna24 (27665082-27665152)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (27665114-27665116)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna11 (15157511-15157441)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (15157479-15157477)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna19 (4341368-4341298)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (4341336-4341334)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna8 (11719864-11719934)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (11719896-11719898)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna9 (11738484-11738554)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (11738516-11738518)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna12 (12502081-12502151)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (12502113-12502115)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna26 (11696813-11696743)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (11696781-11696779)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2311.trna2 (1335-1265)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (1303-1301)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna39 (2660457-2660387)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (2660425-2660423)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna9 (8865910-8865980)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (8865942-8865944)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna38 (4218104-4218034)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (4218072-4218070)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna6 (3172548-3172618)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (3172580-3172582)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna35 (8756326-8756256)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (8756294-8756292)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna44 (3561351-3561281)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (3561319-3561317)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna10 (7490596-7490666)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (7490628-7490630)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna16 (20197361-20197432)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (20197394-20197396)	Score: 64.49
Seq: GCATCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAAACGCA
Str: >>.>.>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<.<.<<.
                    
scaffold_3.trna28 (13783536-13783465)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (13783503-13783501)	Score: 66.45
Seq: GAGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >.>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<.<.
                    
scaffold_18.trna3 (1497675-1497746)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (1497708-1497710)	Score: 68.39
Seq: GCGTTTGTAGTCCAACGGTcAGGATAATTGCCTTCCAAGCAATAGATCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna23 (24960391-24960462)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (24960424-24960426)	Score: 71.06
Seq: GCGTTTGTAGTCCAACGGTcAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna19 (24054378-24054449)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (24054411-24054413)	Score: 72.24
Seq: GCGTTTGTAGTCCAACGGTcAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAAACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna20 (25965900-25965971)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (25965933-25965935)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1207.trna1 (154-83)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (121-119)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna22 (3933612-3933541)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (3933579-3933577)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna73 (3522053-3521982)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (3522020-3522018)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna2 (1227086-1227157)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (1227119-1227121)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna13 (861803-861732)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (861770-861768)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna30 (19676933-19676862)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (19676900-19676898)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna26 (11773869-11773798)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (11773836-11773834)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna41 (4365421-4365350)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (4365388-4365386)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna5 (6056802-6056873)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (6056835-6056837)	Score: 73.14
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna6 (10607646-10607717)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (10607679-10607681)	Score: 74.33
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAAACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna68 (7804552-7804481)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (7804519-7804517)	Score: 74.33
Seq: GCGTTTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAAACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna8 (8602997-8603063)	Length: 67 bp
Type: His	Anticodon: GTG at 29-31 (8603025-8603027)	Score: 34.05
Seq: GTGGCTGTACAAGGTAGAATTCTACGTTGTGGCCGTAGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>......<....>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna35 (4829115-4829044)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (4829082-4829080)	Score: 56.89
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCTCA
Str: >.>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<.<.
                    
scaffold_10.trna16 (18937417-18937488)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (18937450-18937452)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna19 (19507369-19507440)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (19507402-19507404)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna5 (13475768-13475839)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (13475801-13475803)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna41 (2886869-2886798)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (2886836-2886834)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna43 (2308859-2308788)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (2308826-2308824)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna28 (18701116-18701045)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (18701083-18701081)	Score: 63.70
Seq: GTGGCTGTAGTTTAGTGGTgAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna53 (29725805-29725734)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (29725772-29725770)	Score: 63.70
Seq: GTGGCTGTAGTTTAGTGGTgAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_21.trna3 (349593-349522)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (349560-349558)	Score: 63.70
Seq: GTGGCTGTAGTTTAGTGGTgAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna16 (17413519-17413590)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (17413552-17413554)	Score: 63.70
Seq: GTGGCTGTAGTTTAGTGGTgAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna34 (8914716-8914645)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (8914683-8914681)	Score: 63.70
Seq: GTGGCTGTAGTTTAGTGGTgAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna6 (3101363-3101434)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (3101396-3101398)	Score: 63.70
Seq: GTGGCTGTAGTTTAGTGGTgAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna11 (12259287-12259360)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (12259321-12259323)	Score: 76.24
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACGTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<.
                    
scaffold_5.trna37 (8243991-8243918)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (8243957-8243955)	Score: 79.79
Seq: GGCCTATTAGCTCAGCTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAGACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna30 (10852728-10852655)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (10852694-10852692)	Score: 81.44
Seq: GGCCTATTAGCTCAGCTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna25 (20151550-20151477)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (20151516-20151514)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna9 (13704720-13704793)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (13704754-13704756)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna24 (7658975-7658902)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (7658941-7658939)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna3 (2118467-2118540)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (2118501-2118503)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna25 (286351-286278)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (286317-286315)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna13 (3019778-3019705)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (3019744-3019742)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna9 (13556047-13555974)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (13556013-13556011)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna21 (18672772-18672699)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (18672738-18672736)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna15 (16235703-16235776)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (16235737-16235739)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna23 (164838-164765)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (164804-164802)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna3 (1684778-1684851)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (1684812-1684814)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna31 (7312094-7312021)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (7312060-7312058)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna19 (9445747-9445820)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (9445781-9445783)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna31 (9259959-9259886)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (9259925-9259923)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna6 (6328530-6328603)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (6328564-6328566)	Score: 83.89
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna13 (12172024-12171951)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (12171990-12171988)	Score: 85.07
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna21 (17204215-17204133)	Length: 83 bp
Type: Ile	Anticodon: AAT at 34-36 (17204182-17204180)	Score: 23.59
Possible intron: 38-46 (17204178-17204170)
Seq: TAGTAGGTGGCTCAATGGTaAGAGTTTGAGACTAATGgatttgcttCTCCTATGAtTTCAGGTTCGAACCTTGtGGTTGCTAA
Str: >>>>>>...>>>>........<<<<.>>.>>................<<.<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_15.trna5 (10380843-10380914)	Length: 72 bp
Type: Ile	Anticodon: GAT at 34-36 (10380876-10380878)	Score: 54.13
Seq: TCGACCTTAGCTCAGTGGCgAGAGCAGAGGGCTGATTCCTCTAGGtCGCTGGTTCGATTCCGGCAGGTCGAG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna15 (12652670-12652597)	Length: 74 bp
Type: Ile	Anticodon: TAT at 34-36 (12652637-12652635)	Score: 30.34
Seq: GTATTCATAGCTGAATGATtAAAGCACCTAACTTATTATTGGTGAAttCGTAGGTTCAATTCCTACTGGATGCA
Str: >>>>>>>..>>>..........<<<..>>>>.......<<<<.......>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna20 (6573011-6572940)	Length: 72 bp
Type: Ile	Anticodon: TAT at 32-34 (6572980-6572978)	Score: 34.51
Seq: GTGGCTGTACTTTAATGGTAAATTCCATGCTTATGTggCGTGGAGACCTGGGCTCGAATCCCAGCAGTCACA
Str: >>>>>>>...>>>......<<<..>>>>>.........<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna11 (12325242-12325315)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (12325276-12325278)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna39 (37595007-37595080)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (37595041-37595043)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna57 (27384048-27383975)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (27384014-27384012)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna7 (14802231-14802158)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (14802197-14802195)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_267.trna1 (17556-17629)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (17590-17592)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna39 (5830175-5830102)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (5830141-5830139)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna36 (7249464-7249391)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (7249430-7249428)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna8 (10872069-10872149)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (10872104-10872106)	Score: 68.97
Seq: GTGGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCCACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna32 (30315177-30315257)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (30315212-30315214)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna4 (5588983-5589063)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (5589018-5589020)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna50 (31894184-31894104)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (31894149-31894147)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna13 (12530075-12530155)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (12530110-12530112)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna3 (6168054-6168134)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (6168089-6168091)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna4 (5441513-5441593)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (5441548-5441550)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna27 (11512658-11512578)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (11512623-11512621)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna31 (19630199-19630119)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (19630164-19630162)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna39 (6066660-6066580)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (6066625-6066623)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna40 (5998270-5998190)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (5998235-5998233)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna9 (7845320-7845400)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (7845355-7845357)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna12 (5095731-5095651)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (5095696-5095694)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna13 (4940836-4940756)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (4940801-4940799)	Score: 69.68
Seq: GTTGAGATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna6 (11337456-11337538)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (11337489-11337491)	Score: 21.56
Possible intron: 38-43 (11337493-11337498)
Seq: TAGTAAGTGACTCAGTGGTaAGAGTTTGGGATCAAGGggtttgCTCCCCCTGTGGtCTCAGGTTCGAGTCCTGtGGTTGCTAA
Str: >>>>>>...>>>>........<<<<..>>>>.............<<<<.........>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_17.trna10 (11749230-11749147)	Length: 84 bp
Type: Leu	Anticodon: AAG at 34-36 (11749197-11749195)	Score: 22.42
Possible intron: 38-45 (11749193-11749186)
Seq: TAGGTGGTGGCCCAGTGGTaAGAGCTTGGGACCAAGAggtttgctCTCtCTATGGtCCCAGGTTCGAACCCTGtgGTTATTTAT
Str: >>>>>>>..>>.>........<.<<.>>>>>...............<<.<<<.....>>>>>.......<<<<..<<<<<<<<.
                    
scaffold_15.trna16 (11810724-11810643)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (11810692-11810690)	Score: 22.96
Possible intron: 37-42 (11810688-11810683)
Seq: AGGTGGTGGCCCAGTGGTaAGAGCTTGGGACTAAGGggtttgCTCCCTCTTAGGtCTCAGGTTCGAACCCTGTgGTCGCTCA
Str: .>>>>>..>>.>........<.<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_11.trna12 (12829836-12829917)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (12829868-12829870)	Score: 21.26
Possible intron: 37-42 (12829872-12829877)
Seq: AGGTGGTGGCTCAGTGGTaAGAGTTTGGGACCAAGAggtttgCTCCCTCTGTGGtCTCAGGTTCGAATCCTGTgGTTGCTCA
Str: .>>>>>..>>>>........<<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_19.trna7 (13255912-13255830)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (13255879-13255877)	Score: 20.58
Possible intron: 38-46 (13255875-13255867)
Seq: TAATAGGTGGCTCCGTGGTaAGAGCATGAGATTAAGAggtttgtttTTCTTATGGtCTCAAGTTCAAACCCTGtGGTTGCTAA
Str: >>.>>>...>>>>........<<<<.>>>>>................<<<<<.....>>>.>.......<.<<.<.<<<.<<.
                    
scaffold_7.trna7 (14001839-14001756)	Length: 84 bp
Type: Leu	Anticodon: AAG at 34-36 (14001806-14001804)	Score: 25.51
Possible intron: 38-46 (14001802-14001794)
Seq: TAGGTGATGGCTTAGTGGTaAAAGCTTAGGACTAAGAagtttgcttCCTCTATGGtCTCAGGTTCGAGCCCTatGGTTGCTCAT
Str: >.>>>>>..>>>>........<<<<.>>>>..................<<<<.....>>>>>.......<<<..<<<<<<<.<.
                    
scaffold_1.trna13 (14438395-14438473)	Length: 79 bp
Type: Leu	Anticodon: AAG at 32-34 (14438426-14438428)	Score: 28.07
Possible intron: 36-44 (14438430-14438438)
Seq: GCAAGTGGCTCAGTGGTaAGAGCTTGGGACTAAGGggtttgctcCTTCTGTGGtCTCAGGTTCGAGCCCTGTGGTTGCT
Str: >>>>...>>>>........<<<<.>>>>>................<<<<<......>>>>.......<<<<...<<<<.
                    
scaffold_3.trna20 (17372083-17372002)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (17372051-17372049)	Score: 22.53
Possible intron: 37-45 (17372047-17372039)
Seq: GATTGGTGGCCCAGTGGTaAGAGCTTGGGGCTAAGGggtttgctcCCTCTTAGGtCTCAGGTTCGAACCCTGTgGTCGCTCA
Str: >>.>>>..>>.>........<.<<..>>>>................<<<<.......>>>>.......<<<<...<<<.<<.
                    
scaffold_11.trna16 (18310150-18310231)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (18310182-18310184)	Score: 21.07
Possible intron: 37-42 (18310186-18310191)
Seq: AGGTGGTGGCTCAGTGGTaAAAGCTTGGGACTAAGAggtttgCTCCCTCTGTGGtCTCAGGTTCGAGCCCTGTgGTTACTCA
Str: .>>>>>..>>>..........<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_13.trna6 (2203786-2203867)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (2203818-2203820)	Score: 22.96
Possible intron: 37-42 (2203822-2203827)
Seq: AGGTGGTGGCCCAGTGGTaAGAGCTTGGGACTAAGGggtttgCTCCCTCTTAGGtCTCAGGTTCGAACCCTGTgGTCGCTCA
Str: .>>>>>..>>.>........<.<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_2.trna16 (22393229-22393311)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (22393262-22393264)	Score: 26.29
Possible intron: 38-46 (22393266-22393274)
Seq: TAATTGGTGGTTTAGTGGTaAGAACTTGGGGTTAAGAggtttgcttCCCCTGTGGtCTCAGGTTCGAGCCCTGtGGTTACTAA
Str: >>.>.>...>>>>........<<<<.>>>>>................<<<<<.....>>>>>.......<<<<.<.<.<.<<.
                    
scaffold_1.trna17 (22762180-22762262)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (22762213-22762215)	Score: 36.85
Possible intron: 38-46 (22762217-22762225)
Seq: TAGTGGATGGCTCAGTGGTaAGAGTTTAGGACTAAGGggtttgttcCTCCTGTGAtTTCAGGTTCGAACCCTGtGGTTGCTAA
Str: >>>>>>...>>>>........<<<<.>>>>>................<<<<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_1.trna31 (29656018-29656100)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (29656051-29656053)	Score: 31.83
Possible intron: 38-46 (29656055-29656063)
Seq: TAGTAGGTGGCTCAGTGGTaAGAACGTGGGACTAAGGggtttgctcTTCCTGTGGtCTCAGGTTCGAGCCCTGtGGTTGCTAA
Str: >>>>>>...>.>>........<<.<.>>>>>................<<<<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_1.trna74 (3099068-3098987)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (3099036-3099034)	Score: 21.07
Possible intron: 37-42 (3099032-3099027)
Seq: AGGTGGTGGCTCAGTGGTaAGAGCTTGGGACCAAGAggtttgCTCCCTCTGTGGtCTCAGGTTCGAGTCCTGTgGTTGCTCA
Str: .>>>>>..>>>>........<<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_7.trna17 (3112000-3111918)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (3111967-3111965)	Score: 25.71
Possible intron: 38-43 (3111963-3111958)
Seq: TAGTAGGTGGCTCAGTGGTaAGAGTTTGGGATCAAGGggtttgCTCCCCCTGTAGtCTCAGGTTCGAACCCTGtGGTTACTAA
Str: >>>>>>...>>>>........<<<<..>>>>.............<<<<.........>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_1.trna38 (37547911-37547993)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (37547944-37547946)	Score: 28.55
Possible intron: 38-46 (37547948-37547956)
Seq: TAGTAGGTGGTCTAGTGGTaAGAACTTGGGATTAAGGggtttgtttCTCCTGTGGtCTCAGGTTCGAGCCCTGtGGTTGTTAA
Str: >>>>>>...>>.>........<.<<.>>>>>................<<<<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_1.trna48 (41602154-41602073)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (41602122-41602120)	Score: 20.66
Possible intron: 37-45 (41602118-41602110)
Seq: AGGTGGTGGCCCAGTGGTaAGAGCTTGGGGCTAAGGggtttgctcCCTCTTAGGtCTCAGGTTCGAACCCTGTgGTCGCTCA
Str: .>>>>>..>>.>........<.<<..>>>>................<<<<.......>>>>.......<<<<...<<<<<..
                    
scaffold_802.trna1 (4223-4138)	Length: 86 bp
Type: Leu	Anticodon: AAG at 35-37 (4189-4187)	Score: 20.73
Possible intron: 39-44 (4185-4180)
Seq: ATAGGTGgTGGCCCAGTGGTaAGAGCTTGGGACTAAGGggtttgCTCCCTCTTAGGtCTCAGGTTCGAACCCTGTggaCGCTCATA
Str: >>.>>>>...>>.>........<.<<..>>>>.............<<<<..........>>>>.......<<<<....<<<<.<<.
                    
scaffold_15.trna4 (4253081-4253162)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (4253113-4253115)	Score: 21.71
Possible intron: 37-42 (4253117-4253122)
Seq: AGGTGGTGGCTCAGTGGTaAGAGCTTGGGACCAAGAgatttgCTCCCTCTGTGGtCTCAGGTTCGAGTCCTGTgGTTGCTCA
Str: .>>>>>..>>>>........<<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_18.trna11 (4867748-4867667)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (4867716-4867714)	Score: 20.69
Possible intron: 37-42 (4867712-4867707)
Seq: AGGTGGTGGCTCAGTGGTaAGAGCTTGGGACCAAGAggtttgCTCCCTCTATGGtCTCAGGTTCGAGCCCTGTgGTTGCTAA
Str: .>>>>>..>>>>........<<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_7.trna3 (6419089-6419170)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (6419121-6419123)	Score: 21.14
Possible intron: 37-42 (6419125-6419130)
Seq: AGGTGGTGGCTCAGTGGTaAGAGCTTGGGACCAAGAggtttgCTCCCTTTGTGGtCTCAGGTTCGAGCCCTGTgGTTGCTCA
Str: .>>>>>..>>>>........<<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_4.trna10 (7083225-7083306)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (7083257-7083259)	Score: 21.07
Possible intron: 37-42 (7083261-7083266)
Seq: TGGTGGTGGCTCAGTGGTaAGAGCTTGGGACCAAGAggtttgCTCCCTCTGTGGtCTCAGGTTCGAGTCCTGTgGTTGCTCA
Str: .>>>>>..>>>>........<<<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_11.trna1 (856622-856704)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (856655-856657)	Score: 23.26
Possible intron: 38-46 (856659-856667)
Seq: TAAGTGGTGGCTCAGTGGTaAGAGCTTGGGACTAAGAgatttgcttTTTCTGTGGtCTCAGGTTCGAGCCTCGtATTGCTTAT
Str: >>>>>>>..>>>>........<<<<.>>>>>................<<<<<.....>>.>>.......<<.<.<<<<<<<<.
                    
scaffold_16.trna18 (8953184-8953102)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (8953151-8953149)	Score: 23.98
Possible intron: 38-43 (8953147-8953142)
Seq: TAGTAGGTGGTCCAGTGGTaAGAGCTTGGGACTAAGGggtttgCTCCCCTTCTGGtTTCAGGTTCGAGCCCTGtGGTTGCTAA
Str: >>>>>>...>>.>........<.<<..>>>>.............<<<<.........>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_19.trna8 (9025997-9025915)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (9025964-9025962)	Score: 28.57
Possible intron: 38-43 (9025960-9025955)
Seq: TAGTAGGTGGCCTAGTGGTaAGAGCTTGGGACTAAGGggtttgCTCCCTATGTGGtCTCAGGTTCGAACCCTGtAGTTGCTAA
Str: >>>>>>...>>.>........<.<<..>>>>.............<<<<.........>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_15.trna19 (9709127-9709044)	Length: 84 bp
Type: Leu	Anticodon: AAG at 34-36 (9709094-9709092)	Score: 24.52
Possible intron: 38-43 (9709090-9709085)
Seq: TAAGTGGTGGCTCAATGGTaAAAGCTTGGGACTAAGAggtttgCTCCCTCTATGGtTTCAGGTTCGAATCCTGcgATTGCTTAT
Str: >>>>>>>..>>>..........<<<..>>>>.............<<<<.........>>>>>.......<<<<..<<<<<<<<.
                    
scaffold_1.trna66 (9323404-9323324)	Length: 81 bp
Type: Leu	Anticodon: CAA at 34-36 (9323371-9323369)	Score: 26.28
Seq: GTCTTGGTGGTGAAATGATAgACACACGAGACTCAAAATCTCGTGCTAAAGAGCGTGGAGGTTCGAGTCCTCCATAATATT
Str: >>.>>>...>>>..........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<.<<<.<<.
                    
scaffold_9.trna27 (10807172-10807092)	Length: 81 bp
Type: Leu	Anticodon: CAA at 34-36 (10807139-10807137)	Score: 33.99
Seq: GCCTTGGTAGTGAAATGATAgACACGCGAGACTCAAAATCTCGTGCTAAAGAGTgTGGAGGTTTGAGTCCTCTTCAAGGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<..>>....<<...>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna16 (13242789-13242872)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (13242823-13242825)	Score: 64.17
Seq: GTAAGGATGGCCGAGTGGTttAAGGCCCCAGACTCAAGTTCTGGTCCTCGTGAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>.>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<.<<.
                    
scaffold_12.trna26 (4518585-4518505)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (4518550-4518548)	Score: 68.57
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCATGGGTTCGAATCCCATTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna3 (3846773-3846853)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (3846808-3846810)	Score: 68.57
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCATGGGTTCGAATCCCATTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna2 (485880-485960)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (485915-485917)	Score: 68.57
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCATGGGTTCGAATCCCATTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna3 (486043-486123)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (486078-486080)	Score: 68.57
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCATGGGTTCGAATCCCATTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna36 (8044809-8044729)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (8044774-8044772)	Score: 68.57
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCATGGGTTCGAATCCCATTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna42 (1012289-1012209)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (1012254-1012252)	Score: 68.57
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCATGGGTTCGAATCCCATTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna43 (1326450-1326367)	Length: 84 bp
Type: Leu	Anticodon: CAG at 34-36 (1326417-1326415)	Score: 24.33
Possible intron: 38-43 (1326413-1326408)
Seq: TAGGTGATGGCTCAGTGGTaAGAGCTTGGGACCCAGAggtttgCTCCCTCTGTGGtCTCAGGTTCGAGCCCTGcgGTTGCTCAT
Str: >.>>>>>..>>>>........<<<<..>>>>.............<<<<.........>>>>>.......<<<<..<<<<<<.<.
                    
scaffold_2.trna14 (14580079-14580161)	Length: 83 bp
Type: Leu	Anticodon: GAG at 34-36 (14580112-14580114)	Score: 28.36
Possible intron: 38-45 (14580116-14580123)
Seq: TAGTAGGTAGCTCAGTGATaAGAGTTTGGGACTGAGAggtttgctCTCCCtGTGGtTTCAGGTTCGAGTCCTGtGCTTGCTAA
Str: >>>>>>>..>>>>........<<<<.>>>>>...............<<<<.<.....>>>>>.......<<<<.<<<<<<<<.
                    
scaffold_6.trna11 (8967723-8967805)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (8967756-8967758)	Score: 26.52
Seq: GCAGGTTTGCCCGAGAGTTtGAGGGGGACGGTTTAAGATCTTCTATACATAAGCACGCGTGGGTTCGAACCCCACGGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>.>>.......<<.<<..>.>....<.<...>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna7 (8036879-8036961)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (8036912-8036914)	Score: 64.80
Seq: GCTGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGATCTTCTGCACATAAGTGCGCATGGGTTCGAACCCCATAGCCAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna18 (2651009-2650927)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (2650976-2650974)	Score: 65.18
Seq: GCTGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGATCTTCTGTACATAAGTACGCATGGGTTCGAACCCCATAGCCAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna2 (1340390-1340472)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (1340423-1340425)	Score: 65.18
Seq: GCTGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGATCTTCTGTACATAAGTACGCATGGGTTCGAACCCCATAGCCAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna5 (5081166-5081248)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (5081199-5081201)	Score: 66.37
Seq: GCAGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGATCTTCTGTACATAAGTACGCGTGGGTTCGAACCCCACAGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna22 (19676703-19676785)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (19676736-19676738)	Score: 69.55
Seq: GCTGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGATCTTCTGTGCATAAGCACGCGTGGGTTCGAACCCCACAGCCAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna24 (11773652-11773734)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (11773685-11773687)	Score: 74.09
Seq: GCTGGTTTGCCCGAGTGGTtAAGGGGGAAGACTTAAGATCTTCTGTGCATAAGCACGCGTGGGTTCGAACCCCACAGCCAGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna10 (3574336-3574265)	Length: 72 bp
Type: Lys	Anticodon: CTT at 33-35 (3574304-3574302)	Score: 79.91
Seq: GCCTCTGTAGCACAGTGGTAGTGCATTTGCCTCTTAAGCAAGAAGtCGTGAGTTCGAACCTCACCAGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna13 (17194819-17194891)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (17194852-17194854)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna21 (20045986-20046058)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (20046019-20046021)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna32 (8067009-8066937)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (8066976-8066974)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna21 (4939827-4939755)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (4939794-4939792)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna72 (6118284-6118212)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (6118251-6118249)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna10 (10041020-10040948)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (10040987-10040985)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna28 (11030590-11030518)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (11030557-11030555)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna7 (6863795-6863867)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (6863828-6863830)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna25 (15882359-15882287)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (15882326-15882324)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna13 (6418394-6418466)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (6418427-6418429)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna18 (14038167-14038239)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (14038200-14038202)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna6 (6212969-6213041)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (6213002-6213004)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna1 (5687283-5687355)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (5687316-5687318)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna13 (11911867-11911939)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (11911900-11911902)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna37 (4420226-4420154)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (4420193-4420191)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna7 (3242477-3242549)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (3242510-3242512)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna9 (4938843-4938914)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (4938875-4938877)	Score: 72.48
Seq: GCCTCTGTAGCACAGTGGTAGTGCATTTGCCTTTTAAGCAAGAAGtCGTGAGTTCGAACCTCACCAGGAGCA
Str: >>.>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<.<<.
                    
scaffold_12.trna22 (10614448-10614377)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (10614416-10614414)	Score: 74.80
Seq: GCTTCTGTAGCACAGTGGTAGTGCATTTGCCTTTTAAGCAAGAAGtCGTGAGTTCGAACCTCACCAGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna23 (10613041-10612970)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (10613009-10613007)	Score: 74.80
Seq: GCTTCTGTAGCACAGTGGTAGTGCATTTGCCTTTTAAGCAAGAAGtCGTGAGTTCGAACCTCACCAGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna17 (11642579-11642508)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (11642547-11642545)	Score: 84.47
Seq: GCCGTCTTAGCTCAGAGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna20 (12927346-12927275)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (12927314-12927312)	Score: 84.47
Seq: GCCGTCTTAGCTCAGAGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna22 (20104995-20105067)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (20105028-20105030)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna30 (16073417-16073345)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (16073384-16073382)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna17 (17077517-17077445)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (17077484-17077482)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna15 (12352223-12352295)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (12352256-12352258)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna44 (46575931-46576003)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (46575964-46575966)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna13 (14906330-14906402)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (14906363-14906365)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna63 (23996549-23996477)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (23996516-23996514)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna17 (22396431-22396503)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (22396464-22396466)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna10 (5395218-5395290)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (5395251-5395253)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna45 (1726915-1726843)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (1726882-1726880)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna8 (3304215-3304287)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (3304248-3304250)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna3 (4296709-4296781)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (4296742-4296744)	Score: 88.06
Seq: GCCGTCTTAGCTCAGCTGGTAGAGCGCATGGCTTTTAACCATGTGGtCGTGGGTTCGATTCCCACAGACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna16 (12627345-12627273)	Length: 73 bp
Type: Met	Anticodon: CAT at 33-35 (12627313-12627311)	Score: 48.97
Seq: GCATCTATGGTTGAATGGTtAAAGCACCAACTCATAATTGGTGAATTTGTAGGTTCAATTCCTACTAGATGCA
Str: >>>>>>>..>>>..........<<<.>>>>.......<<<<.......>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna18 (16641068-16640997)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (16641036-16641034)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna19 (16636003-16635932)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (16635971-16635969)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna20 (16629175-16629104)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (16629143-16629141)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna31 (850371-850300)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (850339-850337)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna43 (45254587-45254658)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (45254619-45254621)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna47 (45249561-45249490)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (45249529-45249527)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna20 (6332271-6332200)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (6332239-6332237)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna15 (17081925-17081996)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (17081957-17081959)	Score: 67.87
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCTGGATCGAAACCAGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna67 (7961131-7961060)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (7961099-7961097)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna24 (11406256-11406185)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (11406224-11406222)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna13 (11321771-11321842)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (11321803-11321805)	Score: 69.15
Seq: AGCGGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCCGCTA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna11 (12044998-12045069)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (12045030-12045032)	Score: 69.15
Seq: AGCGGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCCGCTA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna34 (10400397-10400313)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (10400363-10400361)	Score: 61.15
Possible intron: 39-49 (10400359-10400349)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna28 (14384511-14384427)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (14384477-14384475)	Score: 61.15
Possible intron: 39-49 (14384473-14384463)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna22 (16941361-16941277)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (16941327-16941325)	Score: 61.15
Possible intron: 39-49 (16941323-16941313)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna3 (1915081-1915165)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (1915115-1915117)	Score: 61.15
Possible intron: 39-49 (1915119-1915129)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna18 (23020885-23020801)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (23020851-23020849)	Score: 61.15
Possible intron: 39-49 (23020847-23020837)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna33 (30422991-30423075)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (30423025-30423027)	Score: 61.15
Possible intron: 39-49 (30423029-30423039)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna16 (3645992-3645908)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (3645958-3645956)	Score: 61.15
Possible intron: 39-49 (3645954-3645944)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna1 (381053-381138)	Length: 86 bp
Type: Met	Anticodon: CAT at 35-37 (381087-381089)	Score: 61.84
Possible intron: 39-50 (381091-381102)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttaaagagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>.....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna1 (424995-425079)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (425029-425031)	Score: 61.71
Possible intron: 39-49 (425033-425043)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctaaagagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna10 (5119867-5119951)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (5119901-5119903)	Score: 61.15
Possible intron: 39-49 (5119905-5119915)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna43 (5360665-5360581)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (5360631-5360629)	Score: 61.15
Possible intron: 39-49 (5360627-5360617)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna34 (7050094-7050010)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (7050060-7050058)	Score: 61.15
Possible intron: 39-49 (7050056-7050046)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgcttctgagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna35 (7344614-7344529)	Length: 86 bp
Type: Met	Anticodon: CAT at 35-37 (7344580-7344578)	Score: 62.48
Possible intron: 39-50 (7344576-7344565)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctaaaagagttATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>.....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna27 (15266992-15266911)	Length: 82 bp
Type: Phe	Anticodon: AAA at 34-36 (15266959-15266957)	Score: 30.34
Possible intron: 38-45 (15266955-15266948)
Seq: TAGTAGGTAGTCTAGTGGTAAGAgCTTGAGATTAAAAaatttgctCTCTTATGGtCTCAGGTTCGAGCCCTGtGGTTGCTAA
Str: >>>>>>...>>>>.......<<<.<.>>>>>...............<<<<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_7.trna20 (2051695-2051613)	Length: 83 bp
Type: Phe	Anticodon: AAA at 34-36 (2051662-2051660)	Score: 20.49
Possible intron: 38-46 (2051658-2051650)
Seq: TAGTAGGTGGCTCAGTGATaAGAGCTTGAGACTAAAGggtttgcttCCTTTGTGGtCTCAGGTTCGAGTCCTGtGGTTGCTAA
Str: >>>>>>...>>>>........<<<<.>>>>..................<<<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_2.trna19 (22576536-22576454)	Length: 83 bp
Type: Phe	Anticodon: AAA at 34-36 (22576503-22576501)	Score: 25.49
Possible intron: 38-46 (22576499-22576491)
Seq: TAGTAGGTATCTTAGTGGTaAGAGTTTGAGATTAAAAgatttgtttTTCTTGTGAtCTCAAGTTCGAGTCTTGtGGTTGCTAA
Str: >>>>>>....>>>........<<<..>>>>>................<<<<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_2.trna31 (8293929-8293848)	Length: 82 bp
Type: Phe	Anticodon: AAA at 33-35 (8293897-8293895)	Score: 21.79
Possible intron: 37-46 (8293893-8293884)
Seq: AGGTGGTGGCCCAGTGGTaAAAGCTTGAGACTAAAAggtttgttccTTCTATGGtCTCAGGTTCGAGCCCTGTgGTTGCTTA
Str: >>>>>>..>>............<<.>.>>>.................<<<<......>>>>.......<<<<...<<<<<<.
                    
scaffold_10.trna23 (21304016-21304088)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (21304049-21304051)	Score: 35.89
Seq: GCGGTGATAGCTCAGTTGGGAGAGCGTCAGGCTGAATTTCTGTACGtCGCGTGTTCTGTCCACGCTCCCCGCA
Str: >>>>.>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<.<<<<.
                    
scaffold_13.trna10 (13860902-13860974)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (13860935-13860937)	Score: 74.98
Seq: GCGGGGATAGCTCAGCTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_11.trna13 (14553157-14553229)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (14553190-14553192)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_11.trna21 (15313548-15313476)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (15313515-15313513)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_13.trna17 (13860511-13860439)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (13860478-13860476)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_13.trna23 (265889-265817)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (265856-265854)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_14.trna15 (8310599-8310527)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (8310566-8310564)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_14.trna16 (8209390-8209318)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (8209357-8209355)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_16.trna26 (230018-229946)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (229985-229983)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_1.trna69 (7432005-7431933)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (7431972-7431970)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_18.trna1 (730143-730215)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (730176-730178)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_2.trna22 (15117760-15117688)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (15117727-15117725)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_2.trna23 (14933642-14933570)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (14933609-14933607)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_3.trna29 (13487046-13486974)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (13487013-13487011)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_5.trna15 (8760077-8760149)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (8760110-8760112)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_5.trna49 (266544-266472)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (266511-266509)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_6.trna22 (24281082-24281154)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (24281115-24281117)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_7.trna8 (13703533-13703461)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (13703500-13703498)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
scaffold_9.trna14 (8129506-8129577)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (8129538-8129540)	Score: 64.76
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCAAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<.
                    
scaffold_10.trna17 (18997944-18998015)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (18997976-18997978)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna18 (19444811-19444882)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (19444843-19444845)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna29 (17983607-17983536)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (17983575-17983573)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna28 (28602765-28602836)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (28602797-28602799)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna5 (1845245-1845316)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (1845277-1845279)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna14 (9594526-9594455)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (9594494-9594492)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna19 (8308351-8308280)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (8308319-8308317)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna20 (19612859-19612788)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (19612827-19612825)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna9 (2986470-2986541)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (2986502-2986504)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna17 (13877646-13877575)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (13877614-13877612)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna40 (3128422-3128351)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (3128390-3128388)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna42 (2840329-2840258)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (2840297-2840295)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna9 (3665283-3665354)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (3665315-3665317)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna2 (1262767-1262838)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (1262799-1262801)	Score: 69.81
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCGTGAGTTCGATTCTCGCAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna2 (628786-628857)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (628818-628820)	Score: 74.11
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCGCGAGTTCGATTCTCGCAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna7 (5705096-5705167)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (5705128-5705130)	Score: 74.11
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCGCGAGTTCGATTCTCGCAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna18 (21682011-21682082)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (21682043-21682045)	Score: 74.11
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCGCGAGTTCGATTCTCGCAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna2 (5574370-5574443)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (5574404-5574406)	Score: 30.35
Seq: AGGGATGTAGAACAATTtGGTAGCGCGTTTGTTTTGGGTATAAAATGtCATGGGTTCAAATCCTATTATTCTTA
Str: >>>>>>>..>..>.........<..<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna11 (3488606-3488533)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (3488572-3488570)	Score: 35.94
Seq: AGGGATGTAGCGCAGCTtGGTAGCGTGTTTGTTTTGGGTACAAAATGtCACAGGTTCAAATCCTCTCTACTTAT
Str: .>>>..>..>>>>.........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<..<<<..
                    
scaffold_9.trna17 (8132960-8133031)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (8132992-8132994)	Score: 47.81
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGTTTTGGGTGCGAGAGGtCCCGAGTATGATTCTCAGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
scaffold_1.trna30 (28604642-28604713)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (28604674-28604676)	Score: 50.34
Seq: TGGCATTTGGTCTAGTGGTATGATTCTTGCTTTGGGTGCAAGAGGtCCAGAGTTTAATTCTCGGAATGCCCC
Str: .>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<..
                    
scaffold_784.trna1 (6767-6840)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (6801-6803)	Score: 54.45
Seq: AGGGATGTAGCGCAGCTtGGTAGCGTGTTTGTTTTGGGTACAAAATGtCACAGGTTCAAATCCTGTTATCTCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna12 (12914515-12914586)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (12914547-12914549)	Score: 69.35
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCTCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna13 (8128977-8129048)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (8129009-8129011)	Score: 73.53
Seq: GGGCATTTGGTCTAGTGGTATGATTCTTGCTTTGGGTGCAAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna1 (1196727-1196798)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (1196759-1196761)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna26 (28600715-28600786)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (28600747-28600749)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna27 (28601770-28601841)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (28601802-28601804)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna29 (28603322-28603393)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (28603354-28603356)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna37 (33518105-33518176)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (33518137-33518139)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna10 (9594186-9594257)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (9594218-9594220)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna1 (1500001-1500072)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (1500033-1500035)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna14 (15017303-15017374)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (15017335-15017337)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna18 (10174852-10174781)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10174820-10174818)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna52 (31132145-31132074)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (31132113-31132111)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna45 (2987890-2987819)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (2987858-2987856)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna15 (8130505-8130576)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (8130537-8130539)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna16 (8131727-8131798)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (8131759-8131761)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna37 (2520431-2520360)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (2520399-2520397)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna12 (8125764-8125835)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (8125796-8125798)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna33 (9267377-9267293)	Length: 85 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 20.02
Seq: AGATCTATAaGCTCAAaaTGGAAGAGCGCTCGTTaTCCCAtcatggggtTTTGAGAGGtTGGTGGTTCAAATCCACTTAGATTTT
Str: >>>>>>>...>>>>.........<<<<.>>>>...................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna32 (7747228-7747155)	Length: 74 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 29.80
Seq: TCCGTTGTCATCTAGTCcGGTcAGGATGtCTGGGTTCTCCCAGTTTTTCCCGGGTTCAAATCCCGGCAACGGAT
Str: >>>>>>>..>>>>..........<<<<..>>>>>....<<<<<......>>>>>.......<<<<<<<<<<<<.
                    
scaffold_27.trna1 (101034-101115)	Length: 82 bp
Type: Phe	Anticodon: AAA at 33-35 (101066-101068)	Score: 20.11
Possible intron: 37-42 (101070-101075)
Seq: AGGTGGTGGCCCAGTGGTaAGAGCTTGGGACTAAAAggtttgCTCCCTCTGTGGtCTCAGGTTCGAGCCCTGTgGTTGCTCA
Str: .>>>>>..>>.>........<.<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_30.trna1 (171049-171130)	Length: 82 bp
Type: Phe	Anticodon: AAA at 33-35 (171081-171083)	Score: 20.11
Possible intron: 37-42 (171085-171090)
Seq: AGGTGGTGGCCCAGTGGTaAGAGCTTGGGACTAAAAggtttgCTCCCTCTGTGGtCTCAGGTTCGAGCCCTGTgGTTGCTCA
Str: .>>>>>..>>.>........<.<<..>>>>.............<<<<..........>>>>.......<<<<...<<<<<..
                    
scaffold_17.trna6 (10059431-10059512)	Length: 82 bp
Type: Leu	Anticodon: AAG at 34-36 (10059464-10059466)	Score: 22.12
Possible intron: 38-43 (10059468-10059473)
Seq: TAATAGGTGGCTCAGTGGTaAGAGCTTGGGATTAAGAggttggCTCCCCTGTGGtCTCAGGTTCGAGCCTTGtGGTTGCTAA
Str: >>.>>>...>>>>........<<<<..>>>>.............<<<<........>>>>>.......<<<<.<.<<<.<<.
                    
scaffold_14.trna11 (15201865-15201947)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (15201898-15201900)	Score: 22.40
Possible intron: 38-46 (15201902-15201910)
Seq: TAATAGGTGGCCCAGTGGTaAGAGCTTGGGACTAAGAggtttattcCCCCTGCGGtCTCAGGTTCGAGCCCTGtGGTTGCTAA
Str: >>.>>>...>>.>........<.<<.>>>>..................<<<<.....>>>>>.......<<<<.<.<<<.<<.
                    
scaffold_16.trna4 (1884780-1884862)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (1884813-1884815)	Score: 22.11
Possible intron: 38-46 (1884817-1884825)
Seq: CGGTATGTGGCCCAGTGGTaAGAGCTTGAGACTAAGGggtttgttcCTCCTATGAtCTCAGGTTCGAGCCCTGtGGTTGCTAA
Str: .>>>>....>>.>........<.<<.>>.>>................<<.<<.....>>>>>.......<<<<.<..<<<<..
                    
scaffold_10.trna1 (2483610-2483689)	Length: 80 bp
Type: Leu	Anticodon: AAG at 32-34 (2483641-2483643)	Score: 23.65
Possible intron: 36-44 (2483645-2483653)
Seq: GTCGGTGGCCCAGTGGTaAGAGCTTAGGATCAAGGgatttgctcCTCCTGTGGtCTCAGGTTCGAGTCCTGTGGTTGCTA
Str: >.>>>..>>.>........<.<<.>>>>>................<<<<<......>>>>.......<<<<...<<<.<.
                    
scaffold_1.trna58 (26982388-26982307)	Length: 82 bp
Type: Leu	Anticodon: AAG at 34-36 (26982355-26982353)	Score: 21.30
Possible intron: 38-45 (26982351-26982344)
Seq: TAGTAGGTGGCCTAGTGGTaAGAGCTTAGGATTAAGGggtttgctCTCCTGTGAtCTCAAGTTCGAACCATGtAGTTGCTGA
Str: >>>>>>...>>.>........<.<<.>>>>>...............<<<<<.....>>>.>.......<.<<.<.<<<<<<.
                    
scaffold_1.trna40 (40958784-40958866)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (40958817-40958819)	Score: 22.58
Possible intron: 38-46 (40958821-40958829)
Seq: TAGCAAGTGGCTCAGTGGTaAGAATTTGAGATTAAGGagtttgctcCTCCTGTGGtTTCAGGTTCGAACCCTGaGGTTGCTAA
Str: >>>>>>...>.>>........<<.<.>>.>>................<<.<<.....>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_17.trna2 (5313381-5313464)	Length: 84 bp
Type: Leu	Anticodon: AAG at 34-36 (5313414-5313416)	Score: 24.72
Possible intron: 38-46 (5313418-5313426)
Seq: TAGGTGATGGCTCAGTGGTaAGAGTTTGGGACCAAGAtgtttgtttCTTCTGTGGtTTCAGGTTCGAGCCCTGtgGTTGCTTAT
Str: >>>>>>>..>>>>........<<<<.>>>>>................<<<<<.....>>>>>.......<<<<..<<<<<<<<.
                    
scaffold_13.trna18 (7664793-7664711)	Length: 83 bp
Type: Leu	Anticodon: AAG at 34-36 (7664760-7664758)	Score: 27.48
Possible intron: 38-43 (7664756-7664751)
Seq: TAGTAGGTGGCCCAGTGGTaAGAGTTTGAGACTAAGAggtttaCTCTCCCTGTGGtCTCAGGTTCGAGCCCTGtGGTTGCTAA
Str: >>>>>>...>>.>........<.<<..>>>>.............<<<<.........>>>>>.......<<<<.<.<<<<<<.
                    
scaffold_12.trna6 (7802508-7802589)	Length: 82 bp
Type: Leu	Anticodon: AAG at 33-35 (7802540-7802542)	Score: 20.94
Possible intron: 37-44 (7802544-7802551)
Seq: GGGTGGTAGCTTAGTGGTaAGAGTTTAGGATCAAGAggtttgctTTCtCTGTGGtCTCAGGTTCAAGCCCTGTgGTTGCTCA
Str: >>>>>>..>>>>........<<<<.>>>>>...............<<.<<<......>>>>.......<<<<...<<<<<<.
                    
scaffold_9.trna1 (2134453-2134526)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (2134487-2134489)	Score: 28.23
Seq: GGGGTTATAGCTCAGAAGAttAGAGCATGTGGTTACGAACCACGATGtGGGGGGTTCGAATCCATCCTTGCCCA
Str: >>>......>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<....<<<.
                    
scaffold_2.trna33 (7701972-7701899)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (7701938-7701936)	Score: 33.94
Seq: GGGCTTTTAGCTTAGAGGGTtAGAGTATATAGCTACGAACCACGATGtCAGGGGTTCGAATCCCTCCTCGCCCA
Str: >>>>.....>>>>.........<<<<.>.>.>.......<.<.<......>>>>.......<<<<....<<<<.
                    
scaffold_6.trna17 (20605648-20605721)	Length: 74 bp
Type: Ser	Anticodon: ACT at 35-37 (20605682-20605684)	Score: 25.41
Seq: GGGATTGTAGCTTAAAGGAttAGAGCACGTGGTTACTAACCACAGTGtTAGGAGTTCGAATCCCTCCCTGCCCA
Str: >>>...>..>>>>.........<<<<..>>>>.......<<<<.......>>.>.......<.<<.<...<<<.
                    
scaffold_8.trna4 (2261640-2261723)	Length: 84 bp
Type: Ser	Anticodon: AGA at 34-36 (2261673-2261675)	Score: 36.78
Seq: GTGGACTTGCCGGAGTGGTtATTGATCACGACTAGAAATCGTGGGGGCTCTGCCCGTCCAGGTgtTCGAATCCTGCTGTTCTCG
Str: >.>>>>....>>>........<<<..>>>>>.......<<<<<.>>>>...<<<<...>>>>.........<<<<..<<<<.<.
                    
scaffold_4.trna12 (10171112-10171185)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (10171146-10171148)	Score: 31.05
Seq: GTCTTACTAGCTCAGATGGTtGGAGCTTCATGCTAGTATTGCGAAGAtCGCAGATTCGAAACCTGTATGGGCCA
Str: >.>>>>...>>>>.........<<<<.>>.>>.......<<.<<.....>>>>.........<<<<.<<<<.<.
                    
scaffold_10.trna15 (18087001-18087074)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (18087035-18087037)	Score: 27.47
Seq: GTCTGGTTGGTGCAGTTGGTtTTCACTCTACACGCACACGCAAGAGGtCCTCAGTTCGAACCAGGGCTCAGCCA
Str: >.>>>>...>>>...........<<<.>>.............<<.....>>>.>.......<.<<<.<<<<.<.
                    
scaffold_14.trna23 (3853941-3853870)	Length: 72 bp
Type: Arg	Anticodon: CCG at 33-35 (3853909-3853907)	Score: 46.12
Seq: GGTTCCATGGCGCAATGGTAGCGCGTCTGTCTCCGGTTCAGAAGGtTGCATGTTCTATTCACGTCGGGTTCA
Str: >>.>>>...>>>>.......<<<<.>>>>.........<<<<.....>>.>>.......<<.<<.<<<.<<.
                    
scaffold_13.trna8 (6867287-6867357)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (6867319-6867321)	Score: 30.02
Seq: GGCGACATTGCCAAGTGGTAAGGCGGGGGACTGCAAACCCTTTTtCCCCAGTTCAAATCCAGGTGTCAACC
Str: >..>>>>..>>>.........<<<.>>>>.........<<<<....>>..>.......<..<<<<<<..<.
                    
scaffold_1.trna75 (2650427-2650356)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (2650395-2650393)	Score: 21.32
Seq: GGGGTCCTGGCAGAGCGGTTAGGCGCGCTCCTGCCACTGCCGAGGtTGGGGGTTCGACCCCCTTCTTCGTCG
Str: >>.>.....>>...........<<.>>.>.........<.<<.....>>>>>.......<<<<<...<.<<.
                    
scaffold_6.trna4 (5384770-5384843)	Length: 74 bp
Type: Asp	Anticodon: GTC at 35-37 (5384804-5384806)	Score: 41.63
Seq: GGGATTGTAGTTCAATTGGTcAGAGCACCACCCTGTCAAGGCGGAAGcTGCATGTTCGAGCCCCGTCAGTCCCG
Str: >>>>>>>..>>>>.........<<<<.>>.>>.......<<.<<.....>>..>.......<..<<<<<<<<<.
                    
scaffold_1.trna55 (28730934-28730861)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (28730900-28730898)	Score: 28.58
Seq: GTTGGAGTAGCTCAGCTAGTtAGTCCGTGTGGCTGTTAATCATAAGCtTGAAAGTTCAAACCCTTCCTCTAGCT
Str: >>>>>>>..>..>.........<..<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<.
                    
scaffold_2.trna4 (4466759-4466832)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (4466793-4466795)	Score: 32.77
Seq: GCTGGAGTAGCTAAGTTGGTtAGAGCGCATGGTTGTTAACCGAAAGGcCGAAGGCTCAAACACTTGCTCTAGCG
Str: >>>>>>>..>>>...........<<<...>>>.......<<<........>>>.........<<<.<<<<<<<.
                    
scaffold_19.trna6 (13987228-13987157)	Length: 72 bp
Type: Ala	Anticodon: TGC at 33-35 (13987196-13987194)	Score: 28.86
Seq: CTAATTGTAGCTCAAATGGTAGAGCGCTGCTTTGCATGCGAGAGGtACAGTGTTCGATCCCCTGCATCTCCA
Str: ..>..>>..>>>>........<<<<.>>>>.......<<.<<.....>>>.>.......<.<<<<<..<...
                    
scaffold_5.trna6 (2924543-2924614)	Length: 72 bp
Type: Ala	Anticodon: TGC at 33-35 (2924575-2924577)	Score: 28.86
Seq: CTAATTGTAGCTCAAATGGTAGAGCGCTGCTTTGCATGCGAGAGGtACAGTGTTCGATCCCCTGCATCTCCA
Str: ..>..>>..>>>>........<<<<.>>>>.......<<.<<.....>>>.>.......<.<<<<<..<...
                    
scaffold_369.trna1 (16106-16178)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (16139-16141)	Score: 34.67
Seq: GCGGACGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGtACAAGGTTAGATCCCCTGCATTCTAT
Str: ..>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<.<<<...
                    
scaffold_19.trna12 (2466463-2466390)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (2466429-2466427)	Score: 27.25
Seq: AGGGATGCAGTGCAGCTTGAcAGCGTGTTTGTTTTGGGTACAAAATAtAACGGGTTCAAATCCTGTCATCCCTG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna7 (6306321-6306392)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (6306353-6306355)	Score: 52.11
Seq: GCCGTCTTAGCTCAGAGGTACAGCGCATGACTTTTAACCATATGGtCGTTGGTTCGATCCCCACAGATGACG
Str: >.>>>>>..>>>.........<<<..>>>.........<<<......>>.>>.......<<.<<<<<<<.<.
                    
scaffold_8.trna25 (10692959-10692888)	Length: 72 bp
Type: SeC	Anticodon: TCA at 34-36 (10692926-10692924)	Score: 48.04
Seq: GTGTCCATTGTCCAGTGGAtAGGACAGAGGTCTTCAAAACCTTTGATAGTGGTTCAAATTCTGTTGGACACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>..>>.......<<..<<<<<<<<.
                    
scaffold_10.trna26 (19577722-19577641)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (19577689-19577687)	Score: 81.33
Seq: GTGGACATGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCTGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna13 (14429815-14429734)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (14429782-14429780)	Score: 81.33
Seq: GTGGACATGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCTGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna29 (22199997-22199916)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (22199964-22199962)	Score: 81.33
Seq: GTGGACATGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCTGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna14 (11782345-11782426)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (11782378-11782380)	Score: 81.73
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna35 (6841864-6841783)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (6841831-6841829)	Score: 81.73
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna31 (12244066-12243985)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (12244033-12244031)	Score: 82.35
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna29 (11440208-11440127)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (11440175-11440173)	Score: 82.35
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna11 (8438754-8438835)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (8438787-8438789)	Score: 82.35
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna23 (11590557-11590476)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (11590524-11590522)	Score: 82.35
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna4 (8556865-8556946)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (8556898-8556900)	Score: 82.83
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna37 (7381577-7381496)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (7381544-7381542)	Score: 82.83
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna8 (6864380-6864461)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (6864413-6864415)	Score: 82.83
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna14 (14782133-14782214)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (14782166-14782168)	Score: 84.12
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTCCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna34 (7420455-7420374)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (7420422-7420420)	Score: 39.61
Seq: GTCGATATGTCCGAGTGATtAAGGAGACGGACTCGATATCTGTTGGGCTTTTCCTGCGCTGGTTCAAATCCTTCTGTCGGCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>.....<<<..>..>>.......<<..<<<<<<<<.
                    
scaffold_6.trna28 (24062780-24062699)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (24062747-24062745)	Score: 77.47
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTCGAAATCTGTTGGGCTGTGCCTGCGCAGGTTCGAATCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna56 (27578056-27577975)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (27578023-27578021)	Score: 78.47
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTCGAAATCTGTTGGGCTATGCCTGCGCAGGTTCGAATCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna3 (6133207-6133288)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (6133240-6133242)	Score: 78.47
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTCGAAATCTGTTGGGCTATGCCTGCGCAGGTTCGAATCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna18 (467172-467091)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (467139-467137)	Score: 81.28
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTCGAAATCTGTTGGGCTTTGCCTGCGCAGGTTCGAATCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna21 (4363986-4363916)	Length: 71 bp
Type: Ser	Anticodon: GCT at 33-35 (4363954-4363952)	Score: 24.60
Seq: ATAGATGTAGTCGAATGGTTAAACTTCTCTTTGCTAAGGAGAAAATGTGGGTTTAATTCCCGCTATATATC
Str: >>>.>>>..>>...........<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<.<<<.
                    
scaffold_15.trna22 (1500616-1500529)	Length: 88 bp
Type: Ser	Anticodon: GCT at 35-37 (1500582-1500580)	Score: 30.92
Seq: GGAGAGATGGCTGACTGGAccAAAGCGCCGGATTGCTAATCCGTTGTATGAGTTATTCGTACCGAGGGTACGAATCCCTCTCTTACCA
Str: >>.>>>>..>>>...........<<<..>>>>.......<<<<...>>>>>>...<<<<<<..>>>>>.......<<<<<<<<<.<<.
                    
scaffold_6.trna25 (25702439-25702514)	Length: 76 bp
Type: Ser	Anticodon: GCT at 35-37 (25702473-25702475)	Score: 36.20
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCTACTCGCTCCTTTGGTCGTGtCTTGAGTTCGACTCTCAACGAAAGCA
Str: >>>.>>>..>>>>.........<<<<.>>.>.........<.<<.......>>>>>.......<<<<<<<<.<<<.
                    
scaffold_9.trna4 (5828925-5829006)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (5828958-5828960)	Score: 73.55
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAATACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>.........<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna12 (13532559-13532640)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (13532592-13532594)	Score: 77.62
Seq: GACGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna21 (26311718-26311799)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (26311751-26311753)	Score: 77.62
Seq: GACGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna5 (8029614-8029695)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (8029647-8029649)	Score: 77.62
Seq: GACGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna6 (8034587-8034668)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (8034620-8034622)	Score: 77.62
Seq: GACGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna13 (11679700-11679781)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (11679733-11679735)	Score: 77.62
Seq: GACGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna7 (6366433-6366514)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (6366466-6366468)	Score: 77.62
Seq: GACGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna18 (23204564-23204645)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (23204597-23204599)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna34 (30678681-30678762)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (30678714-30678716)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna4 (6747569-6747650)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (6747602-6747604)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna29 (19760969-19760888)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (19760936-19760934)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna22 (11713655-11713574)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (11713622-11713620)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna25 (11852809-11852728)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (11852776-11852774)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna8 (14149304-14149390)	Length: 87 bp
Type: Ser	Anticodon: GGA at 35-37 (14149338-14149340)	Score: 51.44
Seq: GGAGAGATGGCCAAGTGGTttAAGGCGTAGCATTGGAAATGCTATGTAGGCTTTTGTTTACCGAGGGTTTGAATCCCTCTCTTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna26 (25971664-25971583)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (25971631-25971629)	Score: 72.22
Seq: GTCGATATGTCCGAGTGGTcAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGTGCAGGTTCGAACCCTGCTGTCGATG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna46 (2652266-2652185)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (2652233-2652231)	Score: 78.02
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTACGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna15 (2457765-2457684)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (2457732-2457730)	Score: 78.27
Seq: GTCGATATGTCCGAGTGGTtAAGGAGATAGACTTGAAATCTATTGGGCTACGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna9 (10944694-10944775)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (10944727-10944729)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna51 (31858322-31858241)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (31858289-31858287)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_15.trna7 (11697110-11697191)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (11697143-11697145)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_18.trna16 (2457392-2457311)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (2457359-2457357)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna23 (16433145-16433064)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (16433112-16433110)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna12 (14832373-14832292)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (14832340-14832338)	Score: 81.08
Seq: GTCGATATGTCCGAGTGGTtAAGGAGATAGACTTGAAATCTATTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna12 (10533186-10533257)	Length: 72 bp
Type: Sup	Anticodon: TTA at 32-34 (10533217-10533219)	Score: 32.75
Seq: GTGACTGTACTTTAATGGTAAATTCCATGCCTTAGTtgCGTGGAGACCTGGGCTCGAATCCCAGCAGTCACA
Str: >>>>>>>...>>>......<<<..>>>>>.........<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna22 (680886-680813)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (680852-680850)	Score: 69.74
Seq: GCTCTCGTAGCTCAGTTtGGTAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCGACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna33 (19184694-19184621)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (19184660-19184658)	Score: 71.72
Seq: GCTTTCATAGCTCAGTTGGGtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCGACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna8 (8792434-8792507)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (8792468-8792470)	Score: 74.28
Seq: GCTTTCATAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna2 (1648488-1648561)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (1648522-1648524)	Score: 76.90
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCGACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna10 (8934000-8934073)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (8934034-8934036)	Score: 76.90
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCGACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna48 (1336955-1336882)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (1336921-1336919)	Score: 76.90
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCGACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna11 (15457889-15457960)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (15457921-15457923)	Score: 82.42
Seq: GCTTCCATAGCATAGTGGTAGTGCGTTCGCTTCGTAAGCGAAAGGtCGCGAGTTCGATCCTCGCTGGGAGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna1 (269543-269614)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (269575-269577)	Score: 82.42
Seq: GCTTCCATAGCATAGTGGTAGTGCGTTCGCTTCGTAAGCGAAAGGtCGCGAGTTCGATCCTCGCTGGGAGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna33 (5952221-5952150)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (5952189-5952187)	Score: 82.42
Seq: GCTTCCATAGCATAGTGGTAGTGCGTTCGCTTCGTAAGCGAAAGGtCGCGAGTTCGATCCTCGCTGGGAGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna25 (5780308-5780237)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (5780276-5780274)	Score: 84.43
Seq: GCCTCCGTAGCATAGTGGTAGTGCGTTCGCTTCGTAAGCGAAAGGtCGCGAGTTCGATCCTCGCCGGGGGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna7 (2946655-2946719)	Length: 65 bp
Type: Thr	Anticodon: TGT at 29-31 (2946683-2946685)	Score: 28.53
Seq: TGCAGCTCAAATGGTAGAGCGCTCGCTTTGTATGCGAGAAGtGCAGGGTTCGATCCCCCCTGCAT
Str: >>>>>>>>........<<<<.>>>>>.......<<<<<.......>>>.......<<<..<<<<.
                    
scaffold_5.trna14 (6453552-6453623)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (6453584-6453586)	Score: 65.33
Seq: GCCCCTATAGCTCAGTGGTACAGCGTCAGTATTGTAAACTGAAGGtCTGTAGTTCGATCCTGCATGGGGGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna8 (13162139-13162210)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (13162171-13162173)	Score: 73.39
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCTGTAGTTCGATCCTGCATGGAGGCA
Str: >>>.>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
scaffold_1.trna70 (7316231-7316160)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (7316199-7316197)	Score: 78.52
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCTGTAGTTCGATCCTGCATGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna2 (5820352-5820423)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (5820384-5820386)	Score: 78.52
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCTGTAGTTCGATCCTGCATGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna1 (4571260-4571331)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (4571292-4571294)	Score: 81.19
Seq: GCCCTTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGAGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna11 (11061778-11061849)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (11061810-11061812)	Score: 82.64
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna7 (10293717-10293788)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (10293749-10293751)	Score: 82.64
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna24 (1248511-1248440)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (1248479-1248477)	Score: 82.64
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna14 (16677870-16677941)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (16677902-16677904)	Score: 82.64
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna22 (1133416-1133345)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (1133384-1133382)	Score: 82.64
Seq: GCCCCTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGGGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna25 (22632582-22632511)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (22632550-22632548)	Score: 76.38
Seq: GGATCTGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCAGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna26 (22628671-22628600)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (22628639-22628637)	Score: 76.38
Seq: GGATCTGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCAGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna30 (9303176-9303105)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (9303144-9303142)	Score: 76.38
Seq: GGATCTGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCAGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_21.trna1 (590774-590703)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (590742-590740)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_21.trna2 (589303-589232)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (589271-589269)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna1 (356311-356382)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (356343-356345)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna30 (10398419-10398348)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (10398387-10398385)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna6 (6451025-6451096)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (6451057-6451059)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna7 (10669497-10669568)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (10669529-10669531)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna33 (15940929-15940858)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (15940897-15940895)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna39 (1066431-1066360)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (1066399-1066397)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna12 (5807073-5807144)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (5807105-5807107)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna23 (25216783-25216712)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (25216751-25216749)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna10 (11953107-11953036)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (11953075-11953073)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna16 (15856348-15856429)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 35-37 (15856382-15856384)	Score: 32.40
Seq: TGGAGAGTGGCCGAGTGCTtaAAAACGAAAGACTGTAAATCTGTTGAAGTTTTCTACGTAGGTTCGAATCCTGCCTCTCCCA
Str: .>>>>>>..>...............<.>.>>>.......<<<.<..>.>...<.<..>>>>>.......<<<<<<<<<<<..
                    
scaffold_10.trna5 (10853507-10853590)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (10853540-10853542)	Score: 77.11
Possible intron: 38-48 (10853544-10853554)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgttgctgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna12 (12128198-12128285)	Length: 88 bp
Type: Tyr	Anticodon: GTA at 34-36 (12128231-12128233)	Score: 76.64
Possible intron: 38-52 (12128235-12128249)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgtagcaatctgtcATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>......................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_16.trna14 (12872341-12872424)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (12872374-12872376)	Score: 72.55
Possible intron: 38-48 (12872378-12872388)
Seq: CCGACCTTAGCTCAGTTGGCAGAGCGGAGGACTGTAGttgttgctgtgATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna4 (14301796-14301704)	Length: 93 bp
Type: Tyr	Anticodon: GTA at 34-36 (14301763-14301761)	Score: 72.93
Possible intron: 38-57 (14301759-14301740)
Seq: CCGACCTTAGCTCAGTTGGCAGAGCGGAGGACTGTAGtgggtaaaatccaaatagccATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...........................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna3 (14304502-14304410)	Length: 93 bp
Type: Tyr	Anticodon: GTA at 34-36 (14304469-14304467)	Score: 72.29
Possible intron: 38-57 (14304465-14304446)
Seq: CCGACCTTAGCTCAGTTGGCAGAGCGGAGGACTGTAGtgggtgaaatccaaatagccATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...........................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna15 (14322330-14322238)	Length: 93 bp
Type: Tyr	Anticodon: GTA at 34-36 (14322297-14322295)	Score: 74.78
Possible intron: 38-57 (14322293-14322274)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtgggtgaaatcctgatggccATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...........................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna19 (16914450-16914533)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (16914483-16914485)	Score: 76.61
Possible intron: 38-48 (16914487-16914497)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggttgctgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna44 (1835122-1835039)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (1835089-1835087)	Score: 76.61
Possible intron: 38-48 (1835085-1835075)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggtagctgttATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna20 (20034116-20034199)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (20034149-20034151)	Score: 77.11
Possible intron: 38-48 (20034153-20034163)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggtttctgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna54 (29725726-29725643)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (29725693-29725691)	Score: 76.33
Possible intron: 38-48 (29725689-29725679)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgttgctgtcATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna45 (47195929-47196019)	Length: 91 bp
Type: Tyr	Anticodon: GTA at 34-36 (47195962-47195964)	Score: 74.39
Possible intron: 38-55 (47195966-47195983)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggtgatgccagcagccaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>.........................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna35 (7030090-7029997)	Length: 94 bp
Type: Tyr	Anticodon: GTA at 34-36 (7030057-7030055)	Score: 75.55
Possible intron: 38-58 (7030053-7030033)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtgggtagatatcctagtagccATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>............................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1081.trna1 (7203-7286)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (7236-7238)	Score: 76.61
Possible intron: 38-48 (7240-7250)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggttgctgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna10 (8512228-8512311)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (8512261-8512263)	Score: 77.11
Possible intron: 38-48 (8512265-8512275)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgttgctgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna36 (9613147-9613059)	Length: 89 bp
Type: Tyr	Anticodon: GTA at 34-36 (9613114-9613112)	Score: 77.68
Possible intron: 38-53 (9613110-9613095)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgtttgtaacagacaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna27 (9843890-9843807)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (9843857-9843855)	Score: 73.33
Possible intron: 38-48 (9843853-9843843)
Seq: CCGACCTTAGCTCAGTTGGCAGAGCGGAGGACTGTAGtggttactgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna22 (9962236-9962319)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (9962269-9962271)	Score: 72.69
Possible intron: 38-48 (9962273-9962283)
Seq: CCGACCTTAGCTCAGTTGGCAGAGCGGAGGACTGTAGtggtgtctgtaATCCTTAGGtCGCTGGTTCGAATCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna3 (2021093-2021153)	Length: 61 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 41.32
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGTGAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>...<....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna20 (22913878-22913958)	Length: 81 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 43.84
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGcCCAGAAGTTCTGGTCTTCGAAAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<..>>>>>...<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna10 (9455622-9455694)	Length: 73 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 50.95
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTAGTGCTCGGCAACtCTTGAGTTCGACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<..>>>........<<<......>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna35 (30840681-30840754)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (30840715-30840717)	Score: 70.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTAAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_3.trna1 (725382-725455)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (725416-725418)	Score: 75.28
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGCCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna3 (7877962-7878035)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (7877996-7877998)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_12.trna17 (13542909-13542982)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (13542943-13542945)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna18 (7233458-7233385)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (7233424-7233422)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna64 (23651449-23651376)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (23651415-23651413)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna17 (16388563-16388636)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (16388597-16388599)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna27 (22391123-22391050)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (22391089-22391087)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_475.trna1 (11768-11695)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (11734-11732)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna29 (8630158-8630085)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (8630124-8630122)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna46 (1111088-1111015)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (1111054-1111052)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna42 (4003638-4003565)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (4003604-4003602)	Score: 76.67
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAGTCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna6 (11009789-11009862)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (11009823-11009825)	Score: 76.93
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_17.trna5 (7059150-7059223)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (7059184-7059186)	Score: 76.93
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna1 (2247365-2247438)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (2247399-2247401)	Score: 76.93
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna21 (12046660-12046587)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (12046626-12046624)	Score: 76.93
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna21 (9621126-9621199)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (9621160-9621162)	Score: 76.93
Seq: GGTGTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGACGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_2.trna25 (11930561-11930488)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (11930527-11930525)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna39 (3595614-3595541)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (3595580-3595578)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_6.trna38 (6799610-6799537)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (6799576-6799574)	Score: 85.69
Seq: GTCTGGGTGGTGTAGTTGGTtATCACGTTAGTCTCACACACTAAAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna25 (110984-110911)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (110950-110948)	Score: 86.07
Seq: GTCTGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_14.trna20 (5856122-5856049)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (5856088-5856086)	Score: 86.07
Seq: GTCTGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_1.trna62 (24410391-24410318)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (24410357-24410355)	Score: 86.07
Seq: GTCTGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna14 (15940721-15940794)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (15940755-15940757)	Score: 86.07
Seq: GTCTGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna40 (4711158-4711085)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (4711124-4711122)	Score: 86.07
Seq: GTCTGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_5.trna41 (5747652-5747579)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (5747618-5747616)	Score: 86.56
Seq: GTCCGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCGGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_7.trna14 (4308581-4308508)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (4308547-4308545)	Score: 86.56
Seq: GTCCGGGTGGTGTAGTTGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCGGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_9.trna43 (1116446-1116374)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1116413-1116411)	Score: 74.40
Seq: GTTGCTGTGGTGTTGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_19.trna5 (14227142-14227070)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (14227109-14227107)	Score: 76.93
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCTCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_10.trna12 (17101767-17101839)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (17101800-17101802)	Score: 81.31
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_11.trna4 (5006510-5006582)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (5006543-5006545)	Score: 81.31
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_13.trna16 (14163274-14163202)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (14163241-14163239)	Score: 81.31
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna23 (21508047-21508119)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (21508080-21508082)	Score: 81.31
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_4.trna5 (2993206-2993278)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (2993239-2993241)	Score: 81.31
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
scaffold_8.trna36 (4526584-4526512)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (4526551-4526549)	Score: 81.31
Seq: GTTGCTGTGGTGTAGTGGTtATCACGTTAGTCTTACACACTAAAGGtCCCCAGTTCGATCCTGGGCAGCAACA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.