GtRNAdb

tRNAscan-SE Analysis of Rhodoferax ferrireducens T118

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


Rhodoferax_ferrireducens_T118.trna44 (378899-378824)	Length: 76 bp
Type: Ala	Anticodon: CGC at 34-36 (378866-378864)	Score: 76.71
Seq: GGGCCGGTAGCTCAGATGGGAGAGCGCTGCGTTCGCAATGCAGAGGtCAGGAGTTCGATCCTCCTTCGGTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna35 (2951704-2951629)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (2951671-2951669)	Score: 83.65
Seq: GGGGGTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCAGCAGTTCGATCCTGCTTACCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna26 (4118083-4118008)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (4118050-4118048)	Score: 87.76
Seq: GGGGGTGTAGCTCAGCTGGGAGAGCGGCTGCTTTGCAAGCAGTAGGtAGCGGGTTCGAGTCCTGTCACCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna28 (4112439-4112364)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (4112406-4112404)	Score: 87.76
Seq: GGGGGTGTAGCTCAGCTGGGAGAGCGGCTGCTTTGCAAGCAGTAGGtAGCGGGTTCGAGTCCTGTCACCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna5 (1587794-1587870)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (1587828-1587830)	Score: 86.55
Seq: GCGGCTGTAGCTCAGTTGGAtAGAGTACTTGGCTACGAACCAAGGGGtCGTGGGTTCAATTCCTGCCAGCCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna1 (207459-207534)	Length: 76 bp
Type: Arg	Anticodon: CCG at 34-36 (207492-207494)	Score: 87.79
Seq: GCGGCTGTAGCTCAGTGGAtAGAGTATTGGCCTCCGAAGCCAAGGGtCGTGGGTTCGATCCCCGCCAGCCGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna11 (1728628-1728702)	Length: 75 bp
Type: Arg	Anticodon: CCT at 34-36 (1728661-1728663)	Score: 59.82
Seq: GCCGTCGTAGTTCAATGGAtAGAACGGGGACCTCCTAAGTCTCAGATATGGGTTCGATTCCCGTCGAGGGCGCCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<.<<<....
                    
Rhodoferax_ferrireducens_T118.trna34 (3114516-3114440)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (3114482-3114480)	Score: 88.58
Seq: CTGCCCGTAGCTCAGTTGGAtAGAGCAACAGCCTTCTAAGCTGTGGGtCGGGGGTTCAATCCCCTCCGGGCAGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna41 (1564597-1564522)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (1564564-1564562)	Score: 86.50
Seq: TCCTCGATAGCTCAGTTGGTAGAGCGCCGGACTGTTAATCCGTAGGtCCCTGGTTCGAGCCCAGGTCGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna37 (2951401-2951325)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2951367-2951365)	Score: 93.78
Seq: GGAGTGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna9 (1681552-1681625)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1681584-1681586)	Score: 55.44
Seq: GGCGCGATAGCAAATCGGTtATGCAACGGATTGCAAATCCGTCTAGCCCAGTTCGACTCTGGGTCGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna12 (1791571-1791647)	Length: 77 bp
Type: Gln	Anticodon: TTG at 35-37 (1791605-1791607)	Score: 73.06
Seq: AGGGGAGTCGCCAAGTTGGTtAAGGCACTGGATTTTGATTCCAGCATgCGAAGGTTCGAATCCTTCTTCCCCTGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna36 (2951570-2951495)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2951536-2951534)	Score: 58.16
Seq: GACCCCATCGTCTAGAGGCctAGGACACTACCCTTTCACGGTAGGTACCGGGGTTCGAATCCCCGTGGGGTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna2 (659339-659412)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (659371-659373)	Score: 73.68
Seq: GCGGGTGTAGTTCAATGGTAGAACGGCAGCTTCCCAAGCTTCATACGAGGGTTCGATTCCCTTCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>.>>>.......<<<.<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna8 (1681424-1681499)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1681457-1681459)	Score: 93.66
Seq: GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCGAGAGTTCGAGTCTCTTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna30 (4011086-4011013)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (4011054-4011052)	Score: 57.92
Seq: GCGGGGTTCGTATAGTGGTAATACCTTAGCCTTCCAAGCTAAAGcGAGGAGTTCGATTCTCCTACCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna16 (2464779-2464854)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (2464812-2464814)	Score: 78.52
Seq: GTGGCTGTAGCTCAGTTGGTAGAGTCCAGGATTGTGATTCCTGTTGtCGTGGGTTCGAGCCCCATCAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118_plasmid1.trna1 (142534-142462)	Length: 73 bp
Type: Ile	Anticodon: GAT at 34-36 (142501-142499)	Score: 78.33
Seq: GGGTGAGTAGCTCAGTTGGTAGAGCGGCTGGTTGATACCCAGTGCGtCGGCGGTTCGATTCCGTCTTCACCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
Rhodoferax_ferrireducens_T118.trna25 (4118186-4118110)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (4118152-4118150)	Score: 88.69
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCACCGTCTTGATAAGGCGGGGGtCGTTGGTTCGAGACCAACCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna27 (4112542-4112466)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (4112508-4112506)	Score: 88.69
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCACCGTCTTGATAAGGCGGGGGtCGTTGGTTCGAGACCAACCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna18 (2619696-2619780)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (2619730-2619732)	Score: 78.53
Seq: GCCCGGGTGGTGGAATTGGTaGACGCACGGGACTCAAAATCCCGCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna39 (2121448-2121364)	Length: 85 bp
Type: Leu	Anticodon: CAG at 35-37 (2121414-2121412)	Score: 75.32
Seq: GCCCGGATGGCGGAATTGGTaGACGCGCACGGTTCAGGTCCGTGTGCCGAAAGGTGTGGAGGTTCGAGTCCTCTTCCGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna6 (1606605-1606689)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (1606639-1606641)	Score: 65.83
Seq: GCCGTCGTGGTGAAATTGGTaGACACGCTATCTTGAGGTGGTAGTGGCGAAAGCTtTGCGAGTTCGAGTCTCGCCGACGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>....<<...>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna10 (1681638-1681730)	Length: 93 bp
Type: Leu	Anticodon: TAA at 35-37 (1681672-1681674)	Score: 69.16
Seq: GCCCGAGTGGTGAAATAGGTaGACACATCGGACTTAAAATCCGCCGCTTCGTGAAtAACGGGCGTACCGGTTCGATTCCGGTCTCGGGCACCA
Str: >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>>>..>....<..<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna7 (1675287-1675373)	Length: 87 bp
Type: Leu	Anticodon: TAG at 35-37 (1675321-1675323)	Score: 73.86
Seq: GCGCGGGTGGCGAAATTGGTaGACGCACCAGGTTTAGGTCCTGACGCTGGAAACAGTGTGGGGGTTCGAGTCCCCCCCCGCGCACCA
Str: >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna22 (3355003-3355078)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (3355036-3355038)	Score: 95.89
Seq: GGGAACTTAGCTCAGTTGGTAGAGCAGCGGACTCTTAATCCGTAGGtCGAGAGTTCGAATCTCTCAGTTCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna20 (3122337-3122412)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (3122370-3122372)	Score: 87.27
Seq: GGGATGTTAGCTCAGTTGGTAGAGCAGCGGACTTTTAATCCGTTTGtCGTGGGTTCGACCCCCGCACATCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna24 (4691721-4691645)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (4691687-4691685)	Score: 84.99
Seq: CGCGCGATGGAGCAGCCtGGTAGCTCGTTGGGCTCATAACCCAAAGGtCGTAGGTTCAAATCCTACTCGCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Rhodoferax_ferrireducens_T118.trna40 (1702020-1701944)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1701986-1701984)	Score: 87.35
Seq: GGCGCTTTAGCTCAGTCGGTtAGAGCGATGGAATCATAATCCACAGGtCCGCGGTTCGAATCCGTGAAGCGCCACCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna33 (3992132-3992057)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (3992099-3992097)	Score: 85.63
Seq: GGCCTGGTAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTTGTGtCGGTGGTTCGATTCCGCCCCGGGCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna43 (1361190-1361114)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (1361156-1361154)	Score: 84.60
Seq: CGGAATGTGGCGCAGCCtGGTAGCGCACTTCGTTCGGGACGAAGGGGtCGGAGGTTCGAATCCTCTCATTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna3 (1447387-1447463)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (1447421-1447423)	Score: 81.95
Seq: CGGTGTGTGGCGCAGCCtGGTAGCGCACTTGCATGGGGTGCAAGGGGtCGAAGGTTCGAATCCTTTCACACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna17 (2583007-2583083)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (2583041-2583043)	Score: 91.14
Seq: CGGGGCGTAGCGCAGCCtGGTAGCGCATCTGGTTTGGGACCAGAGGGtCGAAGGTTCGAATCCTTTCGCCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna23 (3591461-3591548)	Length: 88 bp
Type: Ser	Anticodon: CGA at 35-37 (3591495-3591497)	Score: 71.03
Seq: GGAGAGGTGGCAGAGTGGCcgAATGTACCTGACTCGAAATCAGGCGTACCGCAAGGTACCGTGGGTTCGAATCCCACCCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna4 (1457493-1457585)	Length: 93 bp
Type: Ser	Anticodon: GCT at 35-37 (1457527-1457529)	Score: 66.42
Seq: GGAAACGTGACCGAGTGGCcgAAGGTGCTCCCCTGCTAAGGGAGTATGGGGTGTAGaGCCTCATCGAGGGTTCGAATCCCTCCGTTTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>>.....<<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna13 (2296385-2296474)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (2296419-2296421)	Score: 69.82
Seq: GGAGCGGTGGATGAGTGGTttAAGTCACACGCCTGGAAAGCGTGCGAGGGGTCAAACCCTCCGGGGGTTCGAATCCCCCCTGCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>......<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna42 (1524674-1524587)	Length: 88 bp
Type: Ser	Anticodon: TGA at 35-37 (1524640-1524638)	Score: 65.00
Seq: GGAAGCTTGGCAGAGTGGTcgATTGCACCGGTCTTGAAAACCGGCAAACCGAAAGGTTTCTAGGGTTCGAATCCCTAAGCTTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna19 (2977648-2977723)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (2977681-2977683)	Score: 78.11
Seq: GCCGGTGTAGCTCAGTCGGTAGAGCAGCTCATTCGTAATGAGAAGGtCGGGTGTTCGATTCATCTCTCCGGCACCA
Str: >>>>>.>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<.<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna31 (4010951-4010877)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (4010919-4010917)	Score: 83.93
Seq: GCCCATTTGGCTCAGTGGCAGAGCACTCCCTTGGTAAGGGAGAGGtCCCGGGTCCGATTCCCGGAATGGGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna21 (3275036-3275111)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (3275069-3275071)	Score: 95.29
Seq: GCCGATTTAGCTCAGTTGGTAGAGCAACCGCCTTGTAAGCGGTAGGtCGTCAGTTCGAATCCGACAATCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna32 (4009629-4009554)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (4009596-4009594)	Score: 82.81
Seq: AGGGGCGTAGCTCAATTGGCAGAGCGTCGGTCTCCAAAACCGAAGGtTGATGGTTCGATTCCTTCCGCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna29 (4011260-4011175)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 35-37 (4011226-4011224)	Score: 70.98
Seq: GGAGAGGTGGCCGAGTGGTtaATGGCAGCAGACTGTAAATCTGCCCTCTTACGAGTaCGATGGTTCGAATCCATCCCTCTCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna14 (2381770-2381844)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (2381802-2381804)	Score: 83.69
Seq: GGGCGGTTAGCTCAGGGGTAGAGCACAGCATTCACACTGCTGGGGtCGGAGGTTCGAAGCCTCCACCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna38 (2703011-2702935)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2702977-2702975)	Score: 92.27
Seq: AGGCGCATAGCTCAGCTGGTtAGAGCACCACCTTGACATGGTGGGGGtCGTTGGTTCGAGTCCAATTGCGCCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodoferax_ferrireducens_T118.trna15 (2462673-2462748)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (2462706-2462708)	Score: 94.81
Seq: GGGTGCTTAGCTCAGTTGGTAGAGCGTCTGCCTTACACGCAGAATGtCGGCGGTTCGAGCCCGTCAGCACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.