GtRNAdb

tRNAscan-SE Analysis of Rhodopseudomonas palustris BisB5

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


Rhodopseudomonas_palustris_BisB5.trna43 (776886-776811)	Length: 76 bp
Type: Ala	Anticodon: CGC at 34-36 (776853-776851)	Score: 84.51
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCGTCGTTCGCAATGACGAGGtCGGCGGTTCGATCCCGCCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna50 (212295-212220)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (212262-212260)	Score: 87.23
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCGGCGGTTCGATCCCGCCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna23 (4550552-4550477)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (4550519-4550517)	Score: 86.35
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCGTGCTTTGCAAGCATGAGGtCGTCGGTTCGATCCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna47 (406881-406806)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (406848-406846)	Score: 86.35
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCGTGCTTTGCAAGCATGAGGtCGTCGGTTCGATCCCGTCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna51 (82028-81952)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (81994-81992)	Score: 92.98
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGCACCAGACTACGAATCTGGGGGtCAGAGGTTCGAATCCTTTCGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna42 (852530-852454)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (852496-852494)	Score: 86.37
Seq: GCACCCGTAGCTCAGCTGGAtAGAGCGTTGCCCTCCGAAGGCAAAGGtCACACGTTCGAATCGTGTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna49 (307635-307559)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (307601-307599)	Score: 77.28
Seq: GGTCCCGTAGCTCAGCCGGAtAGAGCGGCGGTTTCCTAAACCGTAGGtCGGATGTTCGAGTCATCCCGGGATCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna15 (3446452-3446528)	Length: 77 bp
Type: Arg	Anticodon: TCG at 35-37 (3446486-3446488)	Score: 85.57
Seq: GCGCTCGTAGCTCAGCTGGAtAGAGCATCGGATTTCGATTCCGAGGGcCGGAGGTTCGAATCCTTCCGAGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna36 (2850486-2850410)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (2850452-2850450)	Score: 80.78
Seq: GGTCCCATAGCTCAACTGGAtAGAGTAGCGGATTTCTACTCCGCGGGtTGCAGGTTCGAATCCTGCTGGGATCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna35 (2886394-2886320)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (2886362-2886360)	Score: 86.74
Seq: TCCCTGGTAGCTCAGTGGTAGAGCAACCGGCTGTTAACCGGTTGGtCGCTGGTTCGAATCCGGCCCGGGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna33 (3216643-3216567)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (3216609-3216607)	Score: 97.02
Seq: GCGGGAGTAGCTCAGTTGGTtAGAGCGCCGGCCTGTCACGCCGGAGGtCGCGGGTTCGAGCCCCGTCTCTCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna40 (2566040-2565965)	Length: 76 bp
Type: Cys	Anticodon: GCA at 33-35 (2566008-2566006)	Score: 59.10
Seq: GGCCCCGTGGCGGAGTGGATACGCAAAGGACTGCAAATCCTTGCAgCGCTGGTTCGAATCCAGCgCGGGGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<.<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna12 (2884542-2884615)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (2884574-2884576)	Score: 65.24
Seq: GGCCACGTGGCGGAGTGGTTACGCGCCGGTCTGCAAAACCGTTTACTCGGGTTCGATTCCCGACGTGGCCTCCA
Str: >>>>>>>..>>>.........<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna16 (3701577-3701650)	Length: 74 bp
Type: Gln	Anticodon: CTG at 33-35 (3701609-3701611)	Score: 70.05
Seq: TGGGGAATGGTGTAACGGTAGCACAACAGACTCTGACTCTGTTTGTCTAGGTTCGAATCCTAGTTCCCCAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna20 (4760534-4760460)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (4760502-4760500)	Score: 69.86
Seq: TGGGGCGTAGCCAAGCGGTAAGGCAGGGGATTTTGATTCCCCCATgCGGAGGTTCGATCCCTCCCGCCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna45 (424443-424369)	Length: 75 bp
Type: Glu	Anticodon: CTC at 34-36 (424410-424408)	Score: 68.86
Seq: GCTCCCTTCGTCTAGCGGTtAGGACGCGGCCCTCTCAAGGCTGAAACAGGGGTTCGATTCCCCTAGGGAGCGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna37 (2829289-2829215)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2829256-2829254)	Score: 60.15
Seq: GCTCCCTTCGTCTATCGGTtAGGACGCCACCCTTTCACGGTGGAGAGAGCGGTTCGATTCCGCTAGGGAGCGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna4 (1026149-1026222)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (1026181-1026183)	Score: 80.62
Seq: GCGGGCGTAGTTCAATGGTAGAACGGCAGCTTCCCAAGCTGCATACGAGGGTTCGATTCCCTTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna2 (524502-524576)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (524534-524536)	Score: 88.17
Seq: GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGAGGGTTCGAATCCCTTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna29 (3563857-3563784)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (3563825-3563823)	Score: 82.33
Seq: GCGGGTGTAGCTCAATGGTAGAGCAGCAGCCTTCCAAGCTGAATACGAGGGTTCGATTCCCTTCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna7 (1620308-1620384)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (1620342-1620344)	Score: 90.83
Seq: GCAGTTGTAGCTCAGTTGGTtAGAGCGCCTGTCTGTGGAACAGGAGGtCGGTGGTTCGAGCCCACCCAACTGTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna22 (4550662-4550586)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (4550628-4550626)	Score: 93.43
Seq: GGGCTTGTAGCTCAGTTGGTtAGAGCGCGCGCTTGATAAGCGTGAGGtCGGAAGTTCAAGTCTTCCCAGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna46 (406991-406915)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (406957-406955)	Score: 93.43
Seq: GGGCTTGTAGCTCAGTTGGTtAGAGCGCGCGCTTGATAAGCGTGAGGtCGGAAGTTCAAGTCTTCCCAGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna48 (379530-379446)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (379496-379494)	Score: 77.17
Seq: GCCCCTGTGGCGGAACTGGTaGACGCGCTCGACTCAAAATCGAGTTCCGCAAGGAGTGCTGGTTCGATTCCGGCCAGGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna1 (198196-198282)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (198230-198232)	Score: 75.87
Seq: GCCCAGGTGGCGGAATTGGTaGACGCGCTGGCTTCAGGTGCCAGTGGCTTCACGGCCGTGAAGGTTCGAGTCCTTTCCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna31 (3428050-3427966)	Length: 85 bp
Type: Leu	Anticodon: GAG at 35-37 (3428016-3428014)	Score: 69.13
Seq: GCGCTCGTGGCGGAATTGGTaGACGCGCTGCCTTGAGGTGGCAGTGAGTAAAATCGTGGGGGTTCGAGTCCCTCCGAGCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>......<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna26 (3647533-3647447)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (3647499-3647497)	Score: 75.66
Seq: GCGGACGTGGCGGAACTGGTaGACGCAAGGGACTTAAAATCCCTCGATGGCAACGTCGTGCGGGTTCGACCCCCGCCGTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna32 (3226361-3226277)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (3226327-3226325)	Score: 78.45
Seq: GCGGGCGTGGCGGAACTGGTaGACGCGCTGGATTTAGGTTCCAGTGACGAAAGTCGTGGGGGTTCGAGTCCCTCCGCCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna9 (2369307-2369382)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (2369340-2369342)	Score: 97.77
Seq: GGGCGCATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGtCCCAGGTTCGAGCCCTGGTGCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna34 (2922333-2922258)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (2922300-2922298)	Score: 91.05
Seq: GAGCGCGTAGCTCAGACGGTAGAGCACGTGACTTTTAATCATGGGGtCGAGGGTTCGAGTCCCTCCGCGCTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna25 (4091348-4091273)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (4091315-4091313)	Score: 80.37
Seq: GGGCCTGTAGCTCAATGGTtAGAGCCGGCCGCTCATAACGGTCTGGtTCCTGGTTCGAGTCCAGGCGGGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna8 (1676578-1676654)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1676612-1676614)	Score: 83.88
Seq: CGCGGGGTGGAGCAGCCcGGTAGCTCGTCAGGCTCATAACCTGAAGGtCATAGGTTCAAATCCTATCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Rhodopseudomonas_palustris_BisB5.trna24 (4408007-4407931)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (4407973-4407971)	Score: 89.01
Seq: GGCGGGGTAGCTCAGCTGGTtAGAGCACGGGAATCATAATCCTGGGGtCGGGGGTTCGAGTCCCTCTCCCGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna21 (4739339-4739264)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (4739306-4739304)	Score: 88.73
Seq: GCCCAGGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGtCGGTGGTTCGATCCCGCCCCTGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna6 (1410553-1410629)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (1410587-1410589)	Score: 85.24
Seq: CGGAGTGTGGCTCAGCCcGGTAGAGCACTGCGTTCGGGACGCAGGGGtCGCAGGTTCAAATCCTGCCACTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna13 (3003929-3004006)	Length: 78 bp
Type: Pro	Anticodon: GGG at 36-38 (3003964-3003966)	Score: 79.64
Seq: CGGAGCGTGGCGCAGCCcGGTtAGCGCACTAGTCTGGGAGACTAGGGGtCGAAGGTTCAAATCCTTTCGCTCCGACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna11 (2833690-2833766)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (2833724-2833726)	Score: 79.83
Seq: CGGGGTATAGCGCAGCCtGGTAGCGCGGCAGTTTTGGGTACTGCAGGtCGTTGGTTCGAATCCAGCTGCCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna10 (2436981-2437051)	Length: 71 bp
Type: Ser	Anticodon: CGA at 51-53 (2437031-2437033)	Score: 34.65
Seq: AGGCTGATAAATGGGACCCGGACTGACTCTTAATCAGCGGGtCCCAGGTTCGAGCCCTGGTGCGCCCACCA
Str: .>>>..>...............>>>>.......<<<<......>>>>>.......<<<<<<..<<<.....
                    
Rhodopseudomonas_palustris_BisB5.trna3 (663698-663787)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (663732-663734)	Score: 76.06
Seq: GGAGAGGTGGCAGAGTGGTcgAATGCACCGCACTCGAAATGCGGCATAGGTGCAAGCCTATCGGGGGTTCGAATCCCTCCCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna38 (2689902-2689809)	Length: 94 bp
Type: Ser	Anticodon: GCT at 35-37 (2689868-2689866)	Score: 76.24
Seq: GGAGACGTGGCCGAGTGGCtgAAGGCGGCGGTTTGCTAAACCGTTATAGGGTTGTAAAGCCCTATCGAGGGTTCGAATCCCTCCGTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>>>....<<<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna5 (1171800-1171889)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (1171834-1171836)	Score: 81.68
Seq: GGAGAGATGGCCGAGTGGCttAAGGCGCACGCTTGGAAAGCGTGTGTGCGGGAAACCGTACCGTGGGTTCGAATCCCACTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna39 (2681606-2681517)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (2681572-2681570)	Score: 83.46
Seq: GGAAGGGTGGCCGAGTGGTttAAGGCACCGGTCTTGAAAACCGGCGTGGGTGCAAGCCCACCGTGGGTTCGAATCCCACCCCTTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna44 (537639-537564)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (537606-537604)	Score: 97.39
Seq: GCCGCAATAGCTCAGCTGGTAGAGCACGTCATTCGTAATGACGGGGtCGGGGGTTCGAATCCCTCTTGCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna18 (4747188-4747262)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (4747220-4747222)	Score: 86.11
Seq: GCTGCCGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGtCGTGAGTTCGATCCTCCCCGGCAGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna27 (3588522-3588448)	Length: 75 bp
Type: Thr	Anticodon: TGT at 33-35 (3588490-3588488)	Score: 83.07
Seq: GCCGGCGTAGCACAGCGGTAGTGCAGCGGTTTTGTAAACCGAAGGtCGGGAGTTCGATCCTCTCCGCCGGCACCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna30 (3553806-3553731)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (3553773-3553771)	Score: 91.15
Seq: AGGAGTGTAGCTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGGGtCGCAGGTTCGAGCCCTGCCACTCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna28 (3585965-3585880)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 35-37 (3585931-3585929)	Score: 75.58
Seq: GGGGGAGTGtCCCGAGTGGCaAAGGGAGCTGACTGTAAATCAGCCGCCTTATGGCTtCGCAGGTTCGAGTCCTGCCTCCCCCACCA
Str: >>>>>>>...>>>..........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna41 (1630061-1629987)	Length: 75 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 36.60
Seq: GGCCCGGTGGCGGAATGTCAACGCGGGGGCagTGCATcGTCCCATATCCTGGTTCAAATCCAGGCCGGGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>........<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna17 (4111391-4111465)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (4111423-4111425)	Score: 81.20
Seq: GGGCGCATAGCTCAGCGGGAGAGCGTTCCCTTCACACGGGAGAGGtCCAAGGTTCGATCCCTTGTGCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna19 (4820206-4820132)	Length: 75 bp
Type: Val	Anticodon: GAC at 33-35 (4820174-4820172)	Score: 89.95
Seq: GGGCGCGTAGCTCAGCGGGAGAGCACCTCGTTGACATCGAGGGGGtCACAGGTTCGATCCCTGTCGCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rhodopseudomonas_palustris_BisB5.trna14 (3219206-3219282)	Length: 77 bp
Type: Val	Anticodon: TAC at 35-37 (3219240-3219242)	Score: 92.05
Seq: GGGCGGCTAGCTCAGCTGGTtAGAGCATCTCGTTTACACCGAGAGGGtCGGGAGTTCGAATCTCTCGCCGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.