GtRNAdb

tRNAscan-SE Analysis of Silicibacter TM1040

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


Silicibacter_sp_TM1040_mega_plasmid.trna12 (403998-403923)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (403965-403963)	Score: 87.77
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGtCAGCGGTTCGATCCCGCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna2 (146698-146773)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (146731-146733)	Score: 89.52
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGATTTGCATTCAGGAGGtCAGGAGTTCGATCCTCCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna15 (177007-176932)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (176974-176972)	Score: 89.52
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGATTTGCATTCAGGAGGtCAGGAGTTCGATCCTCCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna2 (507729-507804)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (507762-507764)	Score: 89.52
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGATTTGCATTCAGGAGGtCAGGAGTTCGATCCTCCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna5 (623981-624056)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (624014-624016)	Score: 89.52
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGATTTGCATTCAGGAGGtCAGGAGTTCGATCCTCCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_plasmid_unnamed.trna3 (12159-12084)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (12126-12124)	Score: 89.52
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGATTTGCATTCAGGAGGtCAGGAGTTCGATCCTCCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna4 (322763-322839)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (322797-322799)	Score: 86.67
Seq: GGACCGATAGCTCAGCTGGAtAGAGTACTTGACTACGAATCAAGGGGtCGGGGGTTCGAATCCTCCTCGGTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna13 (309913-309837)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (309879-309877)	Score: 86.67
Seq: GGACCGATAGCTCAGCTGGAtAGAGTACTTGACTACGAATCAAGGGGtCGGGGGTTCGAATCCTCCTCGGTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna35 (1307135-1307059)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (1307101-1307099)	Score: 89.29
Seq: GCACCTGTAGCTCAGCTGGAtAGAGCGCTGCCCTCCGAAGGCAGAGGcCAGAGGTTCGAATCCTCTCAGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna17 (101795-101719)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (101761-101759)	Score: 86.89
Seq: GGCCCCGTGGCTCAACTGGAtAGAGCAGCCCCCTCCTAAGGGGCAGGtTGCAGGTTCGAATCCTGCCGGGGTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna27 (2821181-2821104)	Length: 78 bp
Type: Arg	Anticodon: TCT at 36-38 (2821146-2821144)	Score: 79.91
Seq: GGGCCGTTAGCTCAGCTGGAttAGAGCAGGGAACTTCTAATTCTCAGGtCGGGGGTTCGAGTCCTCCACGGCTCGCCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna15 (1582218-1582292)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (1582250-1582252)	Score: 87.59
Seq: TCCGGCGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGtCGTAGGTTCGATCCCTACCGCCGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna37 (1051759-1051685)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (1051727-1051725)	Score: 87.59
Seq: TCCGGCGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGtCGTAGGTTCGATCCCTACCGCCGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna10 (910673-910749)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (910707-910709)	Score: 94.74
Seq: GCGGTTGTAGCTCAGTTGGTtAGAGTACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGCCCCGTCAACCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna8 (910354-910430)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (910388-910390)	Score: 94.74
Seq: GCGGTTGTAGCTCAGTTGGTtAGAGTACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGCCCCGTCAACCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna9 (910513-910589)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (910547-910549)	Score: 94.74
Seq: GCGGTTGTAGCTCAGTTGGTtAGAGTACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGCCCCGTCAACCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna31 (1846785-1846712)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1846753-1846751)	Score: 76.36
Seq: GGCGAGTTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACACCGGTTCGATTCCGGTACTCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna5 (572500-572574)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (572532-572534)	Score: 70.93
Seq: TGGGGTGTAGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGTGTAcCGTAGGTTCGAATCCTACCACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna19 (2277500-2277574)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2277533-2277535)	Score: 58.22
Seq: GCTCCGTTCGTCTATCGGTtAGGACGCCAGGTTTTCAACCTGGAAAGAGGGGTTCGATTCCCCTACGGAGTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna20 (2277789-2277863)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2277822-2277824)	Score: 58.22
Seq: GCTCCGTTCGTCTATCGGTtAGGACGCCAGGTTTTCAACCTGGAAAGAGGGGTTCGATTCCCCTACGGAGTACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna13 (1416226-1416299)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (1416258-1416260)	Score: 82.31
Seq: GCGGGTGTAGCTCAATGGTAGAGCAGCAGCTTCCCAAGCTGACGACGAGGGTTCGATTCCCTTCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna16 (2139444-2139518)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (2139476-2139478)	Score: 82.56
Seq: GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGtCGGGCGTTCGAATCGCCTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna17 (2139710-2139784)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (2139742-2139744)	Score: 82.56
Seq: GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGtCGGGCGTTCGAATCGCCTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna18 (2139963-2140037)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (2139995-2139997)	Score: 82.56
Seq: GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGtCGGGCGTTCGAATCGCCTCGCCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna30 (1934912-1934839)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (1934880-1934878)	Score: 66.99
Seq: GCGGGTATGGTGAAATGGTATCATAAGAGCCTTCCAAGCTTAAGGTGCGGGTTCGATTCCCGCTACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna28 (2225540-2225464)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (2225506-2225504)	Score: 83.06
Seq: GCCGCCTTAGCTCAGTTGGTtAGAGCGCTTGATTGTGGATCAAGAGGtCCCTGGTTCGAGACCAGGAGGTGGTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna1 (146556-146632)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (146590-146592)	Score: 94.31
Seq: GGGTCGGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGAGGTTCAAGTCCTCCTCGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna1 (507587-507663)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (507621-507623)	Score: 94.31
Seq: GGGTCGGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGAGGTTCAAGTCCTCCTCGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna14 (177149-177073)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (177115-177113)	Score: 94.31
Seq: GGGTCGGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGAGGTTCAAGTCCTCCTCGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna4 (623839-623915)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (623873-623875)	Score: 94.31
Seq: GGGTCGGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGAGGTTCAAGTCCTCCTCGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_plasmid_unnamed.trna2 (12301-12225)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (12267-12265)	Score: 94.31
Seq: GGGTCGGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGAGGTTCAAGTCCTCCTCGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna12 (1257137-1257222)	Length: 86 bp
Type: Leu	Anticodon: CAA at 34-36 (1257170-1257172)	Score: 71.99
Seq: GCCCAAGTGGCGGAATGGTaGACGCAGGGGATTCAAAATCCCCCGCTGGTGACAGCGTGCCGGTTCGAGTCCGGCCTTGGGTACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>.><.<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna24 (2984740-2984654)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (2984706-2984704)	Score: 78.83
Seq: GCCCAGATGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGCTAGTGTCCGTATGGACGTGGAGGTTCGAGTCCTCTTCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna25 (2984497-2984411)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (2984463-2984461)	Score: 78.83
Seq: GCCCAGATGGCGGAATTGGTaGACGCGCTAGCTTCAGGTGCTAGTGTCCGTATGGACGTGGAGGTTCGAGTCCTCTTCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna18 (56119-56033)	Length: 87 bp
Type: Leu	Anticodon: GAG at 35-37 (56085-56083)	Score: 70.14
Seq: GCGGTCGTGGCGGAATTGGTaGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACtCCCGTGGAAGTTCGAGTCTTCTCGACCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>.....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna32 (1788305-1788222)	Length: 84 bp
Type: Leu	Anticodon: TAA at 34-36 (1788272-1788270)	Score: 76.32
Seq: GCGGGCGTGGTGGAATGGTaGACACAGGGGACTTAAAATCCCCAGGCTTTAGCCGTGCGGGTTCGAGTCCCGCCGCCCGTACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna34 (1416011-1415927)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (1415977-1415975)	Score: 80.62
Seq: GCGGGTGTGGCGGAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGCGTGGGGGTTCAAGTCCCTTCACCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna26 (2972689-2972614)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (2972656-2972654)	Score: 100.36
Seq: GGGCCGTTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTGGGtCGCAGGTTCGAATCCTGCACGGCTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna3 (150565-150641)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (150599-150601)	Score: 80.92
Seq: CGCGGGATGGAGCAGCCaGGTAGCTCGTCAGGCTCATAACCTGAAGGtCGTAGGTTCAAATCCTACTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna16 (173140-173064)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (173106-173104)	Score: 80.92
Seq: CGCGGGATGGAGCAGCCaGGTAGCTCGTCAGGCTCATAACCTGAAGGtCGTAGGTTCAAATCCTACTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna3 (511596-511672)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (511630-511632)	Score: 80.92
Seq: CGCGGGATGGAGCAGCCaGGTAGCTCGTCAGGCTCATAACCTGAAGGtCGTAGGTTCAAATCCTACTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna6 (627848-627924)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (627882-627884)	Score: 80.92
Seq: CGCGGGATGGAGCAGCCaGGTAGCTCGTCAGGCTCATAACCTGAAGGtCGTAGGTTCAAATCCTACTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Silicibacter_sp_TM1040_plasmid_unnamed.trna4 (8348-8272)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (8314-8312)	Score: 80.92
Seq: CGCGGGATGGAGCAGCCaGGTAGCTCGTCAGGCTCATAACCTGAAGGtCGTAGGTTCAAATCCTACTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Silicibacter_sp_TM1040.trna14 (1579604-1579679)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (1579637-1579639)	Score: 86.92
Seq: GGGAGATTAGCTCAGCGGTtAGAGCAGAGCGCTCATAACGCTTTGGtCCAGAGTTCGAATCTCTGATCTCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna39 (452076-452000)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (452042-452040)	Score: 91.49
Seq: GGCGGAGTAGCTCAGTTGGTtAGAGCAGCGGAATCATAATCCGCGTGtCGGGGGTTCAAGTCCCTCCTCCGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna11 (598928-598854)	Length: 75 bp
Type: Phe	Anticodon: GAA at 33-35 (598896-598894)	Score: 80.69
Seq: GCCCGGGTAGCTCAGGGGTAGAGCAGTGGATTGAAAATCCTCGTGtCGGTGGTTCGATTCCGCCCCCGGGCACCA
Str: >>>>>>>..>>>>.......<<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna7 (815593-815517)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (815559-815557)	Score: 78.27
Seq: CGGAGCGTAGCTCAGCCtGGTAGAGCACTGTCTTCGGGAGGCAGGGGcCGGAGGTTCGAATCCTCTCGCTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna38 (972939-972863)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (972905-972903)	Score: 83.39
Seq: CGGGCTATGGCGCAGCCtGGTAGCGCGTCCGTCTGGGGGACGGAAGGtCGCAGGTTCGAGTCCTGCTAGCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna11 (1237578-1237654)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (1237612-1237614)	Score: 85.12
Seq: CGGGGCGTGGCGCAGTCtGGTAGCGCACCTGTTTTGGGTACAGGGGGtCGTGAGTTCGAATCTCGCCGCCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna29 (2153032-2152949)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 33-35 (2153000-2152998)	Score: 32.27
Seq: GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCAcGCCTGGTTCGATTCCAGGGTCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna36 (1289737-1289648)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (1289703-1289701)	Score: 64.26
Seq: GGAGAGGTGCCGGAGTGGTcgAACGGGGCGGTCTCGAAAACCGTTGTGCCTTCACGGGCACCCAGGGTTCGAATCCCTGTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna22 (2576175-2576264)	Length: 90 bp
Type: Ser	Anticodon: GCT at 35-37 (2576209-2576211)	Score: 78.28
Seq: GGAGACGTGGCCGAGTGGTcgAAGGCGCTCCCCTGCTAAGGGAGTAGGCGGGAAACCGTCTCGAGGGTTCGAATCCCTTCGTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna33 (1534119-1534030)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (1534085-1534083)	Score: 69.16
Seq: GGAGAGGTGGCCGAGTGGTcgAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGAAACCGTCTCCAGGGTTCGAATCCCTGTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna9 (637659-637570)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (637625-637623)	Score: 64.45
Seq: GGGGAGGTGGCAGAGTGGTcgAATGCGGCGGTCTTGAAAACCGTTGAACGTGAGAGCGTTCCCAGGGTTCGAATCCCTGTCTCCCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna23 (2994766-2994841)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (2994799-2994801)	Score: 90.45
Seq: GCCTCAATAGCTCAGCTGGTAGAGCAGGTCCTTCGTAAGGACAAGGtCGGGGGTTCGAGTCCCTCTTGAGGCACCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna10 (605990-605916)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (605958-605956)	Score: 88.81
Seq: GCTGCTGTAGCTCAGAGGTAGAGCACTCCCTTGGTAAGGGAGAGGtCGAGAGTTCAATTCTCTCCAGCAGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_mega_plasmid.trna8 (690536-690461)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (690503-690501)	Score: 95.59
Seq: GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTAGGtCCGCGGTTCGAGTCCGTGTGGGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040_plasmid_unnamed.trna1 (23684-23609)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (23651-23649)	Score: 95.59
Seq: GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTAGGtCCGCGGTTCGAGTCCGTGTGGGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna21 (2575693-2575768)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (2575726-2575728)	Score: 88.85
Seq: AGGGGTATAGCTCAGTTGGTAGAGCGACGGTCTCCAAAACCGTAGGtCGCGGGTTCGAACCCTGCTGCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna6 (832030-832104)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (832062-832064)	Score: 85.22
Seq: GGGTGATTAGCTCAGTGGTAGAGCGCTTCGTTCACATCGAAGATGtCAGGAGTTCAAATCTCTTATCACCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna40 (133591-133517)	Length: 75 bp
Type: Val	Anticodon: GAC at 33-35 (133559-133557)	Score: 87.93
Seq: GGGCGGTTAGCTCAGCGGTAGAGCACTTCGTTGACATCGAAGGGGtCACAAGTTCGATCCTTGTACCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Silicibacter_sp_TM1040.trna7 (909925-910000)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (909958-909960)	Score: 89.32
Seq: GGGTCGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGtCGGGAGTTCGAGCCTCTCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.