GtRNAdb

tRNAscan-SE Analysis of Streptococcus pneumoniae D39

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna13 (1862588-1862516)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1862555-1862553)	Score: 84.64
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTAGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna2 (16748-16820)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (16781-16783)	Score: 84.64
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTAGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna26 (1800663-1800591)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1800630-1800628)	Score: 84.64
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTAGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna37 (1703112-1703040)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1703079-1703077)	Score: 84.64
Seq: GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTAGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna34 (1796749-1796676)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (1796715-1796713)	Score: 74.41
Seq: GCACCCTTAGCTCAACTGGAtAGAGTACCTGACTACGAATCAGGCGGtTAGAGGTTCGACTCCTCTAGGGTGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna45 (1699198-1699125)	Length: 74 bp
Type: Arg	Anticodon: ACG at 35-37 (1699164-1699162)	Score: 74.41
Seq: GCACCCTTAGCTCAACTGGAtAGAGTACCTGACTACGAATCAGGCGGtTAGAGGTTCGACTCCTCTAGGGTGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna57 (1139148-1139077)	Length: 72 bp
Type: Arg	Anticodon: CCG at 34-36 (1139115-1139113)	Score: 50.72
Seq: CCACCCTTAGTGTAATGGAtATCACGTAAGATTCCGGTTCTTGAGATGGGGGTTCGATTCCCTCAGGGTGGA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna56 (1180979-1180908)	Length: 72 bp
Type: Arg	Anticodon: CCT at 34-36 (1180946-1180944)	Score: 65.78
Seq: GCTCCCTTAGTTCAATGGAtATAACAACTCCCTCCTAAGGAGTAGtTGCAGGTTCGATTCCTGCAGGGGGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna9 (2043200-2043127)	Length: 74 bp
Type: Arg	Anticodon: TCT at 35-37 (2043166-2043164)	Score: 80.57
Seq: GGTCTCATAGCTCAGCTGGAtAGAGCATTCGCCTTCTAAGCGAACGGtCGCAGGTTCGAATCCTGCTGGGATCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna11 (2040613-2040540)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (2040579-2040577)	Score: 76.37
Seq: TCCGCCATAGCTCAGTTGGTaGTAGCGCATGACTGTTAATCATGATGtCGTAGGTTCGAGTCCTACTGGCGGAG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna3 (20044-20117)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (20078-20080)	Score: 76.37
Seq: TCCGCCATAGCTCAGTTGGTaGTAGCGCATGACTGTTAATCATGATGtCGTAGGTTCGAGTCCTACTGGCGGAG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna28 (1797293-1797221)	Length: 73 bp
Type: Asp	Anticodon: GTC at 34-36 (1797260-1797258)	Score: 73.97
Seq: GGTCCCGTAGTGTAGCGGTtATCACGTCGCCCTGTCACGGCGAAGAtCGCGGGTTCGATTCCCGTCGGGACCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna39 (1699742-1699670)	Length: 73 bp
Type: Asp	Anticodon: GTC at 34-36 (1699709-1699707)	Score: 73.97
Seq: GGTCCCGTAGTGTAGCGGTtATCACGTCGCCCTGTCACGGCGAAGAtCGCGGGTTCGATTCCCGTCGGGACCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna8 (1759580-1759650)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (1759612-1759614)	Score: 60.11
Seq: GGCGGTATAGCCAAGTGGTAAGGCACGGCTCTGCAAAAGCTTGAtCGTCGGTTCAAATCCGTCTACCGCCT
Str: >>>>>>>..>>>.........<<<..>>>>.......<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr.trna23 (1858438-1858367)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (1858406-1858404)	Score: 64.56
Seq: TGGGGTATAGCCAAGCGGTAAGGCAAGGGACTTTGACTCCCTCATgCGTTGGTTCGAATCCAGCTACCCCAG
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna5 (767035-767106)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (767067-767069)	Score: 64.56
Seq: TGGGGTATAGCCAAGCGGTAAGGCAAGGGACTTTGACTCCCTCATgCGTTGGTTCGAATCCAGCTACCCCAG
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna1 (14827-14898)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (14860-14862)	Score: 64.66
Seq: GGTCCGTTGGTCAAGGGGTtAAGACACCGCCTTTTCACGGCGGTAACACGGGTTCGAATCCCGTACGGACTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna10 (2040690-2040619)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (2040657-2040655)	Score: 64.66
Seq: GGTCCGTTGGTCAAGGGGTtAAGACACCGCCTTTTCACGGCGGTAACACGGGTTCGAATCCCGTACGGACTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna12 (1864509-1864438)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1864476-1864474)	Score: 64.66
Seq: GGTCCGTTGGTCAAGGGGTtAAGACACCGCCTTTTCACGGCGGTAACACGGGTTCGAATCCCGTACGGACTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna25 (1802584-1802513)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1802551-1802549)	Score: 64.66
Seq: GGTCCGTTGGTCAAGGGGTtAAGACACCGCCTTTTCACGGCGGTAACACGGGTTCGAATCCCGTACGGACTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna36 (1705033-1704962)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1705000-1704998)	Score: 64.66
Seq: GGTCCGTTGGTCAAGGGGTtAAGACACCGCCTTTTCACGGCGGTAACACGGGTTCGAATCCCGTACGGACTA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna32 (1796923-1796852)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (1796891-1796889)	Score: 83.78
Seq: GCGAACGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGGGGtCGCGGGTTCGAATCCCGTCGTTCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna43 (1699372-1699301)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (1699340-1699338)	Score: 83.78
Seq: GCGAACGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGGGGtCGCGGGTTCGAATCCCGTCGTTCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna15 (1859215-1859145)	Length: 71 bp
Type: Gly	Anticodon: TCC at 33-35 (1859183-1859181)	Score: 71.92
Seq: GCGGGTGTAGTTTAGTGGTAAAACTACAGCCTTCCAAGCTGTTGtCGCGAGTTCGATTCTCGTCACCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna52 (1698587-1698517)	Length: 71 bp
Type: Gly	Anticodon: TCC at 33-35 (1698555-1698553)	Score: 71.92
Seq: GCGGGTGTAGTTTAGTGGTAAAACTACAGCCTTCCAAGCTGTTGtCGCGAGTTCGATTCTCGTCACCCGCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna22 (1858521-1858449)	Length: 73 bp
Type: His	Anticodon: GTG at 34-36 (1858488-1858486)	Score: 59.85
Seq: GCGGGTGTGGTGAAGTGGTtAACACACCAGATTGTGGCTCTGGCATgCGTGGGTTCGATCCCCATCACTCGCC
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna16 (1859110-1859037)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (1859076-1859074)	Score: 86.72
Seq: GGGCGCGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGTGGTTCGAGTCCACTCGTGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna53 (1698481-1698408)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (1698447-1698445)	Score: 86.72
Seq: GGGCGCGTAGCTCAGGTGGTtAGAGCGCACGCCTGATAAGCGTGAGGtCGGTGGTTCGAGTCCACTCGTGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna55 (1429610-1429525)	Length: 86 bp
Type: Leu	Anticodon: AAG at 35-37 (1429576-1429574)	Score: 54.82
Seq: GCGGGGATGGCGGAATTGGCaGACGTGCAGGACTAAGGATCCTGTGACCGCTTTAGGTCGTGAGGGTTCAAGTCCCTCTCTCCGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>......<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna24 (1858357-1858274)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (1858323-1858321)	Score: 70.28
Seq: GCCGGCGTGGCGGAATTGGCaGACGCGCTGGACTCAAAATCCAGTGTCCGCAAGGACGTGCCGGTTCGACCCCGGCCGCCGGTA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna33 (1796844-1796759)	Length: 86 bp
Type: Leu	Anticodon: TAA at 35-37 (1796810-1796808)	Score: 68.91
Seq: GCCGGGGTGGCGGAACTGGCaGACGCACAGGACTTAAAATCCTGCGATTGGTAACGATCGTACCGGTTCGATTCCGGTCCTCGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna44 (1699293-1699208)	Length: 86 bp
Type: Leu	Anticodon: TAA at 35-37 (1699259-1699257)	Score: 68.91
Seq: GCCGGGGTGGCGGAACTGGCaGACGCACAGGACTTAAAATCCTGCGATTGGTAACGATCGTACCGGTTCGATTCCGGTCCTCGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna30 (1797118-1797037)	Length: 82 bp
Type: Leu	Anticodon: TAG at 35-37 (1797084-1797082)	Score: 68.24
Seq: GCGGGTTTGGCGGAATTGGCaGACGCACCAGATTTAGGATCTGGCGCTTAACGGCGTGGGGGTTCAAGTCCCTTAACCCGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna41 (1699567-1699486)	Length: 82 bp
Type: Leu	Anticodon: TAG at 35-37 (1699533-1699531)	Score: 68.24
Seq: GCGGGTTTGGCGGAATTGGCaGACGCACCAGATTTAGGATCTGGCGCTTAACGGCGTGGGGGTTCAAGTCCCTTAACCCGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna7 (1598070-1598142)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (1598103-1598105)	Score: 82.06
Seq: GCCTCCTTAGCTCAGCTGGCAGAGCAGCGGACTCTTAATCCGTGGGtCACAGGTTCGATCCCTGTAGGGGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna29 (1797196-1797124)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (1797163-1797161)	Score: 82.17
Seq: GACTCGTTAGCTCAGTTGGTAGAGCAATTGACTTTTAATCAATGGGtCACTGGTTCGAGCCCAGTACGGGTCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna40 (1699645-1699573)	Length: 73 bp
Type: Lys	Anticodon: TTT at 34-36 (1699612-1699610)	Score: 82.17
Seq: GACTCGTTAGCTCAGTTGGTAGAGCAATTGACTTTTAATCAATGGGtCACTGGTTCGAGCCCAGTACGGGTCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna47 (1699030-1698957)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1698996-1698994)	Score: 76.98
Seq: GGCGGTGTAGCTCAGCTGGCtAGAGCGTCCGGTTCATACCCGGGAGGtCGGGGGTTCGATCCCCTTCGCCGCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna18 (1858853-1858780)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1858819-1858817)	Score: 77.60
Seq: CGCGGGATGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTAGGTTCAAATCCTGCTCCCGCAA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr.trna50 (1698756-1698683)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1698722-1698720)	Score: 77.60
Seq: CGCGGGATGGAGCAGCTcGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTAGGTTCAAATCCTGCTCCCGCAA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr.trna48 (1698943-1698870)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (1698909-1698907)	Score: 86.67
Seq: GGACCTTTAGCTCAGCTGGTtAGAGCTCTCGGCTCATAACCGAGTGGtCGTAGGTTCAAGTCCTACAAGGTCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna19 (1858776-1858704)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (1858743-1858741)	Score: 75.06
Seq: GGCTCGGTAGCTCAGTTGGTAGAGCAATGGATTGAAGCTCCATGTGtCGGCGGTTCGATTCCGTCTCGCGCCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr.trna51 (1698679-1698607)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (1698646-1698644)	Score: 75.06
Seq: GGCTCGGTAGCTCAGTTGGTAGAGCAATGGATTGAAGCTCCATGTGtCGGCGGTTCGATTCCGTCTCGCGCCA
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr.trna35 (1796660-1796587)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (1796626-1796624)	Score: 80.16
Seq: CGGGAAGTAGCTCAGCTtGGTAGAGTACTTGGTTTGGGACCAAGGTGtCGCAGGTTCGAATCCTGTCTTCCCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna46 (1699109-1699036)	Length: 74 bp
Type: Pro	Anticodon: TGG at 35-37 (1699075-1699073)	Score: 80.16
Seq: CGGGAAGTAGCTCAGCTtGGTAGAGTACTTGGTTTGGGACCAAGGTGtCGCAGGTTCGAATCCTGTCTTCCCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna54 (1698401-1698314)	Length: 88 bp
Type: Ser	Anticodon: GCT at 35-37 (1698367-1698365)	Score: 56.13
Seq: GGAGAATTACTCAAGAGGCtgAAGAGGACGGTTTGCTAAATCGTTAGGTCGGGTAACTGGCGCAAGGGTTCGAATCCCTTATTCTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna58 (781755-781668)	Length: 88 bp
Type: Ser	Anticodon: GGA at 35-37 (781721-781719)	Score: 45.29
Seq: GGAAGATTACTCAAGAGGCttAAGAGGCCGTGTTGGAAACGCGGTAGGCGTGTAATAGCGTGCGTGGGTTCGAATCCCATGTCTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>.>>........<<.<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna17 (1858953-1858864)	Length: 90 bp
Type: Ser	Anticodon: TGA at 37-39 (1858917-1858915)	Score: 61.73
Seq: GGAGGATTACCCAAGTCcGGCtgAAGGGAACGGTCTTGAAAACCGTCAGGCGTGTAAAAGCGTGCGTGGGTTCGAATCCCACATCCTCCT
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>.>>.>....<.<<.<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna49 (1698859-1698770)	Length: 90 bp
Type: Ser	Anticodon: TGA at 37-39 (1698823-1698821)	Score: 61.73
Seq: GGAGGATTACCCAAGTCcGGCtgAAGGGAACGGTCTTGAAAACCGTCAGGCGTGTAAAAGCGTGCGTGGGTTCGAATCCCACATCCTCCT
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>.>>.>....<.<<.<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna6 (912395-912467)	Length: 73 bp
Type: Thr	Anticodon: GGT at 34-36 (912428-912430)	Score: 75.79
Seq: GCTGATTTAGCTCAGTTGGCAGAGCGCATCCATGGTAAGGATGAGGtCGCCGGTTCAATCCCGGCAATTAGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna31 (1797018-1796946)	Length: 73 bp
Type: Thr	Anticodon: TGT at 34-36 (1796985-1796983)	Score: 83.52
Seq: GCCGGCTTAGCTCAGTTGGTAGAGCATCTGATTTGTAATCAGAGGGtCGCGTGTTCAAGTCATGTAGCCGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna42 (1699467-1699395)	Length: 73 bp
Type: Thr	Anticodon: TGT at 34-36 (1699434-1699432)	Score: 83.52
Seq: GCCGGCTTAGCTCAGTTGGTAGAGCATCTGATTTGTAATCAGAGGGtCGCGTGTTCAAGTCATGTAGCCGGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna21 (1858606-1858536)	Length: 71 bp
Type: Trp	Anticodon: CCA at 33-35 (1858574-1858572)	Score: 53.01
Seq: ACGGGCATAGTTTAAAGGTAGAACTAAGGTCTCCAAAACCTTCAGTGTGGGTTCAATTCCTACTGCCCGTG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna20 (1858691-1858611)	Length: 81 bp
Type: Tyr	Anticodon: GTA at 35-37 (1858657-1858655)	Score: 65.00
Seq: GGAAGGGTAGCGAAGAGGCtaAACGCGGCGGACTGTAAATCCGCTCCTTCGGGTtCGGGGGTTCGAATCCCTCCCCTTCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>..<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna4 (766945-767025)	Length: 81 bp
Type: Tyr	Anticodon: GTA at 35-37 (766979-766981)	Score: 66.36
Seq: GGAGAGATAGCGAAGAGGCtaAACGCGGCGGACTGTAAATCCGCTCCTTCGGGTtCGGGGGTTCGAATCCCTCTCTCTCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>..<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna14 (1859293-1859221)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1859260-1859258)	Score: 84.84
Seq: GGGAGTTTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGtCAGCGGTTCGATCCCGTTAACTCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna27 (1797368-1797296)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1797335-1797333)	Score: 84.84
Seq: GGGAGTTTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGtCAGCGGTTCGATCCCGTTAACTCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna38 (1699817-1699745)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1699784-1699782)	Score: 84.84
Seq: GGGAGTTTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGtCAGCGGTTCGATCCCGTTAACTCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.