GtRNAdb

tRNAscan-SE Analysis of Thermoanaerobacter tengcongensis

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna15 (989990-990065)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (990023-990025)	Score: 84.52
Seq: GGGGCTGTAGCTCAGTTGGGAGAGCGCCACAATGGCATTGTGGAGGcCGTGGGTTCAAGTCCCATCAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (2155028-2154953)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (2154995-2154993)	Score: 94.72
Seq: GGGGGTGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGtCAGGAGTTCGAATCTCCTCATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna45 (1632154-1632079)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (1632121-1632119)	Score: 98.10
Seq: GGGGACGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGtCGGGAGTTCGAATCTCCTCGTCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna3 (36376-36452)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (36410-36412)	Score: 81.73
Seq: GCGCCCGTAGCTCAATTGGAtAGAGCGCCTGACTACGGATCAGAAGGcTGGGGGTTCGAGTCCCTCCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna19 (1932823-1932898)	Length: 76 bp
Type: Arg	Anticodon: CCG at 34-36 (1932856-1932858)	Score: 89.20
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTTCGGCTCCGGACCGAAAGGtCGCAGGTTCGACTCCTGTCAGGCGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna11 (582044-582120)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (582078-582080)	Score: 80.11
Seq: GCGCCCGTAGCTCAGAAGGAtAGAGCAGCAGTTTCCTAAACTGCGTGcCGGAGGTTCGAGTCCTCTCGGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna49 (627124-627048)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (627090-627088)	Score: 94.61
Seq: GCGCCTGTAGCTCAGCTGGAtAGAGCAACGGCCTTCTAAGCCGTGTGtCGGGAGTTCGAATCTCTCCAGGCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (1701516-1701442)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (1701484-1701482)	Score: 82.94
Seq: TCCTCAGTAGCTCAAGGGTAGAGCAGCCGGCTGTTAACCGGCAGGtTGTAGGTTCGAATCCTACCTGAGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (2151787-2151713)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (2151755-2151753)	Score: 84.13
Seq: TCCTCAGTAGCTCAAGGGTAGAGCAACCGGCTGTTAACCGGTAGGtTGTAGGTTCGAATCCTACCTGAGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna6 (58582-58656)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (58614-58616)	Score: 84.13
Seq: TCCTCAGTAGCTCAAGGGTAGAGCAACCGGCTGTTAACCGGTAGGtTGTAGGTTCGAATCCTACCTGAGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (1682932-1682856)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (1682898-1682896)	Score: 90.89
Seq: GGCCCAGTAGCTCAGCTGGTtAGAGCGCCAGCCTGTCACGCTGGAGGcCGAGGGTTCAAGTCCCTTCTGGGTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna31 (2151519-2151443)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2151485-2151483)	Score: 95.01
Seq: GGCCCAGTAGCTCAGTTGGTtAGAGCGCTAGCCTGTCACGCTAGAGGtCGAGGGTTCAAGTCCCTTCTGGGTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (1682691-1682617)	Length: 75 bp
Type: Cys	Anticodon: GCA at 33-35 (1682659-1682657)	Score: 79.17
Seq: GGCGACATAGCCAAGCGGTAAGGCAGGGGTCTGCAAAACCCCGATtCCCCGGTTCGAATCCGGGTGTCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (937171-937098)	Length: 74 bp
Type: Gln	Anticodon: CTG at 33-35 (937139-937137)	Score: 68.58
Seq: TGCCGAATGGTGTAATGGTAGCACAGGTGACTCTGGATCACCTGGTCTAGGTTCGAGTCCTAGTTCGGCAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna51 (626956-626882)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (626924-626922)	Score: 80.44
Seq: TGGGATGTAGCCAAGCGGTAAGGCACCAGACTTTGACTCTGGCATgCGCAGGTTCGAATCCTGCCATCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna47 (937090-937015)	Length: 76 bp
Type: Glu	Anticodon: CTC at 35-37 (937056-937054)	Score: 69.59
Seq: GGCCCCATCGTCTAGCGGCctAGGACACCGCCCTCTCACGGCGGAGACAGGGGTTCGAGTCCCCTTGGGGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna29 (2151701-2151627)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2151668-2151666)	Score: 77.30
Seq: GGCCCCGTGGTCAAGTGGTtAAGACACCGCCCTTTCACGGCGGTAACATGGGTTCGAATCCCGTCGGGGTCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (2287790-2287716)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (2287757-2287755)	Score: 79.85
Seq: GGCCCCGTGGTCAAGTGGTtAAGACACCGCCCTTTCACGGCGGCAACACGGGTTCGAATCCCGTCGGGGTCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (58782-58856)	Length: 75 bp
Type: Gly	Anticodon: CCC at 33-35 (58814-58816)	Score: 90.20
Seq: GCGGATGTAGCTCAGCGGTAGAGCATCAGCTTCCCAAGCTGAGGGcCGCGGGTTCAAATCCCGTCATCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna43 (1682770-1682695)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1682737-1682735)	Score: 93.43
Seq: GCGGGCATAGCTCAGTTGGCAGAGCATCACCTTGCCAAGGTGAGGGtCGCGAGTTCGAGTCTCGTTGCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna54 (626671-626596)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (626638-626636)	Score: 93.43
Seq: GCGGGCATAGCTCAGTTGGCAGAGCATCACCTTGCCAAGGTGAGGGtCGCGAGTTCGAGTCTCGTTGCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna48 (627202-627129)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (627170-627168)	Score: 85.73
Seq: GCGGGTGTAGCTCAATGGTAGAGCCCCAGCCTTCCAAGCTGGTTGCGTGGGTTCGATTCCCATCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna50 (627036-626960)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (627002-627000)	Score: 80.57
Seq: GTGGATATAGTTCAGGTGGCaAGAACGCCAGATTGTGGCTCTGGAGGtCGTGGGTTCAAGTCCCACTATCCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna27 (2154951-2154875)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (2154917-2154915)	Score: 96.94
Seq: GGGCTTATAGCTCAGTTGGTcAGAGCGCACGCCTGATAAGCGTGAGGtCGATGGTTCGAATCCATCTAAGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (1033384-1033472)	Length: 89 bp
Type: Leu	Anticodon: CAA at 35-37 (1033418-1033420)	Score: 71.98
Seq: GCCGAAGTGGTGGAACTGGCaGACGCGCTGGACTCAAAATCCAGTGGGGCTCACaCCCCGTGCGGGTTCGACTCCCGCCTTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>.......<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna53 (626763-626677)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (626729-626727)	Score: 74.59
Seq: GCGGGAGTGGCGGAATTGGCaGACGCGCTAGATTCAGGTTCTAGTGCCCGAAAGGGCtTATGGGTTCAAGTCCCGTCTCCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (889221-889306)	Length: 86 bp
Type: Leu	Anticodon: GAG at 35-37 (889255-889257)	Score: 63.84
Seq: GCGGCGGTGGCGGAACTGGCaGACGCGTACGTTTGAGGGGCGTATGGGCTAATCCCGTGTGGGTTCAAGTCCCACCCGCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>......<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (2324382-2324471)	Length: 90 bp
Type: Leu	Anticodon: TAA at 35-37 (2324416-2324418)	Score: 78.48
Seq: GCCGGAGTGGCGGAACTGGCaGACGCACAGGACTTAAAATCCTGGGGGCTGAATaAGCCCgTACCGGTTCAAGTCCGGTCTCCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>.....<<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna12 (627401-627485)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (627435-627437)	Score: 78.82
Seq: GCGGGCATGGCGGAATTGGCaGACGCGCCAGACTTAGGATCTGGTGGGGTTTCCCGTGGGGGTTCAAGTCCCTTTGCCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>...<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna55 (626570-626495)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (626537-626535)	Score: 96.48
Seq: GCGCCATTAGCTCAGTTGGCAGAGCAGCTGACTCTTAATCAGCGGGtCCGGGGTTCGAATCCCTGATGGCGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna35 (2132422-2132347)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (2132389-2132387)	Score: 82.91
Seq: GACCCATTAGCTCAGGAGGTAGAGCACCTGCCTTTTAAGCAGGGTGtCCCGCGTTCGAATCGCGGATGGGTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna52 (626877-626802)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (626844-626842)	Score: 82.91
Seq: GACCCATTAGCTCAGGAGGTAGAGCACCTGCCTTTTAAGCAGGGTGtCCCGCGTTCGAGTCGCGGATGGGTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna21 (2324476-2324552)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2324510-2324512)	Score: 83.92
Seq: CGCGGGGTGGAGCAGTCcGGTAGCTCGTCGGGCTCATAACCCGGAGGtCGTGGGTTCAAATCCCACCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna22 (2324558-2324634)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2324592-2324594)	Score: 84.57
Seq: GGCGGCGTAGCTCAGGTGGCtAGAGCATGCGGTTCATACCCGCAGTGtCGGTGGTTCGAATCCACTCGCCGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna30 (2151617-2151542)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (2151584-2151582)	Score: 91.50
Seq: GGGCCTTTAGCTCAGCTGGCAGAGCGGTCGGCTCATAACCGATTGGtCCGGGGTTCAAATCCCTGAAGGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna37 (1701435-1701360)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (1701402-1701400)	Score: 92.63
Seq: GGGCCTTTAGCTCAGCTGGCAGAGCGGTCGGCTCATAACCGATTGGtCCGGGGTTCGAATCCCTGAAGGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (2151433-2151358)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (2151400-2151398)	Score: 88.89
Seq: GCCTCGATAGCTCAGTAGGTAGAGCAAGGGACTGAAAATCCCTGTGtCAGTGGTTCGATTCCACTTCGAGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (1682851-1682776)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (1682818-1682816)	Score: 90.36
Seq: GCCCCGATAGCTCAGTAGGTAGAGCAAGGGACTGAAAATCCCTGTGtCAGTGGTTCGATTCCACTTCGGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna13 (784901-784975)	Length: 75 bp
Type: Pro	Anticodon: CGG at 33-35 (784933-784935)	Score: 85.36
Seq: CGGGGCATGGCGCAGCGGTAGCGCGCGCGGTTCGGGACCGTGAGGtCGCAGGTTCAAATCCTGTTGCCCCGACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna18 (1568952-1569027)	Length: 76 bp
Type: Pro	Anticodon: GGG at 34-36 (1568985-1568987)	Score: 74.61
Seq: CTGGGTGTGGCGCAGCTGGTAGCGCGCCAGAATGGGGTTCTGGAGGcCGGGGGTTCAAGTCCCCCCACTCAGACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna8 (499255-499330)	Length: 76 bp
Type: Pro	Anticodon: TGG at 34-36 (499288-499290)	Score: 92.16
Seq: CGGGATGTAGCGCAGCTGGTAGCGCACGTGCTTTGGGAGCATGGGGtCGGGGGTTCAAGTCCCCCCATCCCGACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (46025-46115)	Length: 91 bp
Type: Ser	Anticodon: CGA at 35-37 (46059-46061)	Score: 80.56
Seq: GGAGAGATGGCTGAGTGGTcgAAAGCGCTCGCCTCGAAAGCGAGTGGGCGAATTTTTCGCCTCGAGGGTTCAAATCCCTCTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>>...<<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna2 (30258-30352)	Length: 95 bp
Type: Ser	Anticodon: GCT at 34-36 (30291-30293)	Score: 69.98
Seq: GGAGAAGTACCCAAGTGGTgAAGGGGCGGTCCTGCTAAGACTGTAGGTCGGGGAAAaaCCCCGGCGCGTGGGTTCGAATCCCACCTTCTCCGCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<..>.>.>>>......<<<.<.<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (46129-46222)	Length: 94 bp
Type: Ser	Anticodon: GGA at 35-37 (46163-46165)	Score: 68.76
Seq: GGAGAGATGACCGAGTGGTcgAAGGTGCACGACTGGAAATCGTGTGTACCCCTAAAaaGGGGTACCGAGGGTTCGAATCCCTCTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>>......<<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna1 (30157-30245)	Length: 89 bp
Type: Ser	Anticodon: TGA at 35-37 (30191-30193)	Score: 76.94
Seq: GGAGAGGTGTCCGAGTGGCttAAGGAGCTGGTCTTGAAAACCAGTGACCCCGCAAGGGGcCGTGGGTTCGAATCCCACCCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>..><..<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna33 (2151343-2151269)	Length: 75 bp
Type: Thr	Anticodon: CGT at 33-35 (2151311-2151309)	Score: 84.58
Seq: GCTAGCGTGGCTCAGAGGCAGAGCAGCTGATTCGTAATCAGCAGGtCGTGGGTTCGAATCCCACCGCTAGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (2193158-2193083)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (2193125-2193123)	Score: 81.65
Seq: GCCCACGTAGCTCAGTAGGCAGAGCGTCGCCTTGGTAAGGCGGAGGtCACCGGTTCGATCCCGGTCGCGGGCTCCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<....
                    
chr.trna23 (2592882-2592807)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (2592849-2592847)	Score: 90.90
Seq: GCTGGCGTAGCTCAATAGGTAGAGCAGCTGACTTGTAATCAGCAGGtTGAAGGTTCGAGTCCTTTCGCCAGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1521836-1521911)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (1521869-1521871)	Score: 83.56
Seq: AGGGGAGTAGCTCAACTGGTAGAGCAACGGTCTCCAAAACCGTGGGcTGCGGGTTCAAGTCCTGTCTCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna10 (499432-499517)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 35-37 (499466-499468)	Score: 74.75
Seq: GGAGGGATACCCAAGCGGCcaAAGGGGGCAGACTGTAAATCTGCTGGCGTATGCCTtCGATGGTTCAAATCCATCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (2132511-2132426)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 35-37 (2132477-2132475)	Score: 74.75
Seq: GGAGGGATACCCAAGCGGCcaAAGGGGGCAGACTGTAAATCTGCTGGCGTATGCCTtCGATGGTTCAAATCCATCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna39 (1692147-1692071)	Length: 77 bp
Type: Val	Anticodon: CAC at 35-37 (1692113-1692111)	Score: 89.67
Seq: GGGGTCATAGCTCAGCTGGTcAGAGCGCTGCGCTCACATCGCAGAGGtCACAGGTTCGACTCCTGTTGACCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna38 (1696339-1696263)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (1696305-1696303)	Score: 88.55
Seq: GGGGTCATAGCTCAGCTGGTtAGAGCGCTACGTTGACATCGTAGAGGcCACAGGTTCAAGTCCTGTTGACCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna40 (1683009-1682934)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (1682976-1682974)	Score: 95.47
Seq: GGTCGTGTAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCATAGGTTCAAGTCCTATCGCGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (499335-499410)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (499368-499370)	Score: 96.59
Seq: GGTCGTGTAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCATAGGTTCGAGTCCTATCGCGACCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.