GtRNAdb

tRNAscan-SE Analysis of Vibrio vulnificus YJ016

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chrI.trna11 (179665-179740)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (179698-179700)	Score: 86.08
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCTGCGGTTCGATCCCGCATAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna63 (2952434-2952359)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (2952401-2952399)	Score: 86.08
Seq: GGGGTTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCTGCGGTTCGATCCCGCATAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna2 (34413-34488)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (34446-34448)	Score: 91.16
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCAGTTCGATCCTGCTTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna57 (3041255-3041180)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (3041222-3041220)	Score: 91.16
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCAGTTCGATCCTGCTTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna69 (2858013-2857937)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2857979-2857977)	Score: 86.52
Seq: GCGCTCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGCGGtCAGAGGTTCGAATCCTCTCGAGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna71 (2857737-2857661)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2857703-2857701)	Score: 86.52
Seq: GCGCTCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGCGGtCAGAGGTTCGAATCCTCTCGAGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna73 (2857449-2857373)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2857415-2857413)	Score: 86.52
Seq: GCGCTCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGCGGtCAGAGGTTCGAATCCTCTCGAGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna75 (2857164-2857088)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2857130-2857128)	Score: 86.52
Seq: GCGCTCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGCGGtCAGAGGTTCGAATCCTCTCGAGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna72 (2857570-2857494)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2857536-2857534)	Score: 87.93
Seq: GCGTCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGCGGtCAGAGGTTCGAATCCTCTCGGACGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna74 (2857283-2857207)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (2857249-2857247)	Score: 87.93
Seq: GCGTCCGTAGCTCAGCTGGAtAGAGTACCTGGCTACGAACCAGGCGGtCAGAGGTTCGAATCCTCTCGGACGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna4 (49176-49252)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (49210-49212)	Score: 92.95
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGCGTTGGCCTCCGGAGCCAAAGGtCGAAGGTTCGAATCCTTTCGGGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna84 (952622-952546)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (952588-952586)	Score: 81.93
Seq: GCTCCCATGGCACAGCTGGAtAGCGCGGCCCCCTCCTAAGGGGCAGGtCACAGGTTCAAATCCTGTTGGGAGCGCCA
Str: >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna78 (2426322-2426246)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (2426288-2426286)	Score: 88.75
Seq: GCGCCCTTAGCTCAGCTGGAtAGAGCACGTCCCTTCTAAGGATGTGGtCGTAGGTTCGAATCCTACAGGGCGTGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna28 (2938344-2938419)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2938377-2938379)	Score: 85.69
Seq: TCCTCCTTAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGtCGCTGGTTCGAGCCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna32 (2940845-2940920)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2940878-2940880)	Score: 85.69
Seq: TCCTCCTTAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGtCGCTGGTTCGAGCCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna34 (2941072-2941147)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2941105-2941107)	Score: 85.69
Seq: TCCTCCTTAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGtCGCTGGTTCGAGCCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna80 (1208789-1208714)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (1208756-1208754)	Score: 85.69
Seq: TCCTCCTTAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGtCGCTGGTTCGAGCCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna9 (1401025-1401100)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (1401058-1401060)	Score: 85.69
Seq: TCCTCCTTAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGtCGCTGGTTCGAGCCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna13 (183328-183404)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (183362-183364)	Score: 97.44
Seq: GGAGCGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna17 (722596-722672)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (722630-722632)	Score: 97.44
Seq: GGAGCGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna36 (3299852-3299776)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (3299818-3299816)	Score: 97.44
Seq: GGAGCGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna40 (3257869-3257793)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (3257835-3257833)	Score: 97.44
Seq: GGAGCGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna58 (3037742-3037666)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (3037708-3037706)	Score: 97.44
Seq: GGAGCGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna67 (2943073-2942997)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2943039-2943037)	Score: 97.44
Seq: GGAGCGGTAGTTCAGTTGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna11 (1022880-1022807)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1022848-1022846)	Score: 60.37
Seq: GGCGCGTTGGCAGAGGGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGACTCCGGGACGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna20 (1249797-1249870)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1249829-1249831)	Score: 64.59
Seq: GGCGCGTTGGCAGAGTGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGACTCCGGGACGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna6 (682945-683018)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (682977-682979)	Score: 64.59
Seq: GGCGCGTTGGCAGAGTGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGACTCCGGGACGCGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna87 (925131-925057)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (925099-925097)	Score: 70.98
Seq: AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATtCCCTGGTTCGAATCCAGGTAGACCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna90 (924718-924644)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (924686-924684)	Score: 70.98
Seq: AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATtCCCTGGTTCGAATCCAGGTAGACCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna94 (924242-924168)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (924210-924208)	Score: 70.98
Seq: AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATtCCCTGGTTCGAATCCAGGTAGACCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna96 (923983-923909)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (923951-923949)	Score: 70.98
Seq: AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATtCCCTGGTTCGAATCCAGGTAGACCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna98 (923722-923648)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (923690-923688)	Score: 70.98
Seq: AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATtCCCTGGTTCGAATCCAGGTAGACCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna14 (718843-718918)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (718877-718879)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna35 (3303364-3303289)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (3303330-3303328)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna37 (3261559-3261484)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (3261525-3261523)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna61 (2952601-2952526)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2952567-2952565)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna65 (2946863-2946788)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2946829-2946827)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna9 (179498-179573)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (179532-179534)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna1 (307253-307328)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (307287-307289)	Score: 57.32
Seq: GTCCCGTTCGTCTAGAGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACTCCCCTACGGGATACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna21 (1249874-1249949)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1249907-1249909)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna23 (1250122-1250197)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1250155-1250157)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna45 (3161695-3161620)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3161662-3161660)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna46 (3161509-3161434)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3161476-3161474)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna47 (3161400-3161325)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3161367-3161365)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna48 (3161229-3161154)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3161196-3161194)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna49 (3161057-3160982)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3161024-3161022)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna51 (3160816-3160741)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (3160783-3160781)	Score: 86.20
Seq: GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCACGAGTTCGAACCTCGTGTGTCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna43 (3251331-3251257)	Length: 75 bp
Type: Gly	Anticodon: TCC at 34-36 (3251298-3251296)	Score: 64.85
Seq: GCGGGCATCGTATAATGGCtATTACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTGCCCGCTCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna10 (1193535-1193461)	Length: 75 bp
Type: Gly	Anticodon: TCC at 34-36 (1193502-1193500)	Score: 64.85
Seq: GCGGGCATCGTATAATGGCtATTACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTGCCCGCTCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna5 (49291-49366)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (49324-49326)	Score: 83.47
Seq: GTGGCTATAGCTCAGTTGGTAGAGTCCCGGATTGTGATTCCGGTTGtCGCGGGTTCGAATCCCGTTAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna7 (49544-49619)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (49577-49579)	Score: 83.47
Seq: GTGGCTATAGCTCAGTTGGTAGAGTCCCGGATTGTGATTCCGGTTGtCGCGGGTTCGAATCCCGTTAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna1 (34326-34402)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (34360-34362)	Score: 96.04
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGTACGCCTGATAAGCGTAAGGtCGGTGGTTCGAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna56 (3041342-3041266)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (3041308-3041306)	Score: 96.04
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGTACGCCTGATAAGCGTAAGGtCGGTGGTTCGAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna60 (2963699-2963615)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (2963665-2963663)	Score: 70.21
Seq: GCCGGTGTGGTGAAATTGGTaTACACGACGGATTCAAAATCCGTTTCCTTCGGGAGTGGCGGTTCAAGTCCGCCCACCGGTACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>..<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna76 (2751382-2751299)	Length: 84 bp
Type: Leu	Anticodon: GAG at 35-37 (2751348-2751346)	Score: 70.67
Seq: GCCGAGATGGTGAAATTGGTaGACACACTAGCATGAGGTGCTAGCGCCTATGGTGTGAGGGTTCGAGTCCCTCTCTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>><<<...>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna12 (516538-516455)	Length: 84 bp
Type: Leu	Anticodon: GAG at 35-37 (516504-516502)	Score: 70.67
Seq: GCCGAGATGGTGAAATTGGTaGACACACTAGCATGAGGTGCTAGCGCCTATGGTGTGAGGGTTCGAGTCCCTCTCTCGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>><<<...>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna22 (1250010-1250096)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (1250044-1250046)	Score: 72.66
Seq: GCCCTGGTGGTGAAATTGGTaGACACAAGGGATTTAAAATCCCTCGACTTTCGAGTCGTGCCGGTTCAAGTCCGGCCCGGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna5 (682826-682912)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (682860-682862)	Score: 72.66
Seq: GCCCTGGTGGTGAAATTGGTaGACACAAGGGATTTAAAATCCCTCGACTTTCGAGTCGTGCCGGTTCAAGTCCGGCCCGGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna86 (925226-925142)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (925192-925190)	Score: 74.05
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna91 (924598-924514)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (924564-924562)	Score: 74.05
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna95 (924123-924039)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (924089-924087)	Score: 74.05
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna97 (923863-923779)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (923829-923827)	Score: 74.05
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna99 (923603-923519)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (923569-923567)	Score: 74.05
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna89 (924860-924776)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (924826-924824)	Score: 77.41
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna93 (924381-924297)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (924347-924345)	Score: 77.41
Seq: GCGGAAGTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGAGAGTTCGAGTCTCTCCTTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna10 (179575-179650)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (179608-179610)	Score: 97.44
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCAGGTTCGAATCCTGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna15 (718920-718995)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (718953-718955)	Score: 97.44
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCAGGTTCGAATCCTGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna38 (3261482-3261407)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (3261449-3261447)	Score: 97.44
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCAGGTTCGAATCCTGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna62 (2952524-2952449)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (2952491-2952489)	Score: 97.44
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCAGGTTCGAATCCTGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna2 (307330-307405)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (307363-307365)	Score: 97.44
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGtCGCAGGTTCGAATCCTGCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna52 (3160687-3160611)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3160653-3160651)	Score: 86.30
Seq: CGCGGGATGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTTGGTTCAAATCCAGCTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna54 (3160450-3160374)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3160416-3160414)	Score: 86.30
Seq: CGCGGGATGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTTGGTTCAAATCCAGCTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna50 (3160927-3160851)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3160893-3160891)	Score: 88.17
Seq: CGCGGGGTGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna53 (3160568-3160492)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3160534-3160532)	Score: 88.17
Seq: CGCGGGGTGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna55 (3160331-3160255)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (3160297-3160295)	Score: 88.17
Seq: CGCGGGGTGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna77 (2751241-2751165)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2751207-2751205)	Score: 88.17
Seq: CGCGGGGTGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chrI.trna100 (542379-542304)	Length: 76 bp
Type: Met	Anticodon: CAT at 34-36 (542346-542344)	Score: 91.55
Seq: GGCCCCTTAGCTCAGTGGTtAGAGCAGTCGACTCATAATCGATTGGtCCCCAGTTCAAGTCTGGGAGGGGCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna85 (925341-925265)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (925307-925305)	Score: 95.33
Seq: GGCTACGTAGCTCAGCTGGTtAGAGCACATCACTCATAATGATGGGGtCACAGGTTCGAATCCCGTCGTAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chrI.trna88 (924979-924903)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (924945-924943)	Score: 95.33
Seq: GGCTACGTAGCTCAGCTGGTtAGAGCACATCACTCATAATGATGGGGtCACAGGTTCGAATCCCGTCGTAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chrI.trna92 (924502-924426)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (924468-924466)	Score: 95.33
Seq: GGCTACGTAGCTCAGCTGGTtAGAGCACATCACTCATAATGATGGGGtCACAGGTTCGAATCCCGTCGTAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chrI.trna31 (2940730-2940805)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (2940763-2940765)	Score: 87.07
Seq: GCCTCGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGtCGGTGGTTCGATTCCGCCTCGAGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna8 (1400913-1400988)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (1400946-1400948)	Score: 87.07
Seq: GCCTCGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGtCGGTGGTTCGATTCCGCCTCGAGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna26 (2938124-2938199)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (2938157-2938159)	Score: 88.50
Seq: GCCCGGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGtCGGTGGTTCGATTCCGCCTCCGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna29 (2940513-2940588)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (2940546-2940548)	Score: 88.50
Seq: GCCCGGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGtCGGTGGTTCGATTCCGCCTCCGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna83 (1067653-1067577)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (1067619-1067617)	Score: 78.82
Seq: CGGACTGTAGCGCAGCTtGGTAGCGCACCGTCATGGGGTGTCGGGGGtCGGAGGTTCAAATCCTCTCAGTCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna19 (940448-940524)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (940482-940484)	Score: 90.76
Seq: CGGTGAATAGCGCAGCTtGGTAGCGCATCTGGTTTGGGACCAGAGGGtCGGGGGTTCGAATCCCTCTTCACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna6 (49393-49469)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (49427-49429)	Score: 90.76
Seq: CGGTGAATAGCGCAGCTtGGTAGCGCATCTGGTTTGGGACCAGAGGGtCGGGGGTTCGAATCCCTCTTCACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna8 (49644-49720)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (49678-49680)	Score: 90.76
Seq: CGGTGAATAGCGCAGCTtGGTAGCGCATCTGGTTTGGGACCAGAGGGtCGGGGGTTCGAATCCCTCTTCACCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna68 (2858134-2858043)	Length: 92 bp
Type: Ser	Anticodon: GCT at 35-37 (2858100-2858098)	Score: 67.92
Seq: GGTGAGGTGGCCGAGAGGCtgAAGGCGCTCCCCTGCTAAGGGAGTATACGGTTTAtCCCGTATCGAGGGTTCGAATCCCTCCTTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>......<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna70 (2857913-2857822)	Length: 92 bp
Type: Ser	Anticodon: GCT at 35-37 (2857879-2857877)	Score: 67.92
Seq: GGTGAGGTGGCCGAGAGGCtgAAGGCGCTCCCCTGCTAAGGGAGTATACGGTTTAtCCCGTATCGAGGGTTCGAATCCCTCCTTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>......<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna79 (2282086-2281999)	Length: 88 bp
Type: Ser	Anticodon: GGA at 35-37 (2282052-2282050)	Score: 65.79
Seq: GGTGAGTTGTCCGAGTGGCtgAAGGAGCACGCCTGGAAAGTGTGTGTACGGCAACGTACCGAGAGTTCGAATCTCTCACTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna4 (311051-311141)	Length: 91 bp
Type: Ser	Anticodon: TGA at 35-37 (311085-311087)	Score: 67.80
Seq: GGAGAGATGGCTGAGTGGTtgAAAGAACCGGTCTTGAAAACCGGCGTACGTTAATaGCGTACCTAGGGTTCAAATCCCTATCTCTCCGCCA
Str: >>>>>>>...>>...........<<..>>>>>.......<<<<<.>>>>>>.....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna3 (38032-38122)	Length: 91 bp
Type: Ser	Anticodon: TGA at 35-37 (38066-38068)	Score: 75.59
Seq: GGAGAGATGGCTGAGTGGTtgAAAGCACCGGTCTTGAAAACCGGCGTACGTTAATaGCGTACCTAGGGTTCAAATCCCTATCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>.....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna81 (1179114-1179024)	Length: 91 bp
Type: Ser	Anticodon: TGA at 35-37 (1179080-1179078)	Score: 75.59
Seq: GGAGAGATGGCTGAGTGGTtgAAAGCACCGGTCTTGAAAACCGGCGTACGTTAATaGCGTACCTAGGGTTCAAATCCCTATCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>.....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna7 (1400790-1400880)	Length: 91 bp
Type: Ser	Anticodon: TGA at 35-37 (1400824-1400826)	Score: 75.59
Seq: GGAGAGATGGCTGAGTGGTtgAAAGCACCGGTCTTGAAAACCGGCGTACGTTAATaGCGTACCTAGGGTTCAAATCCCTATCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>.....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna66 (2943336-2943261)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (2943303-2943301)	Score: 89.50
Seq: GCTGATATGGCTCAGTCGGTAGAGCGCATCCTTGGTAAGGATGAGGtCCCCAGTTCGATTCTGGGTATCAGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna44 (3251242-3251167)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (3251209-3251207)	Score: 91.10
Seq: GCTGATATAGCTCAGGTGGTAGAGCGCATCCTTGGTAAGGATGAGGtCGGCAGTTCGAGTCTGCCTATCAGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna27 (2938254-2938329)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (2938287-2938289)	Score: 91.83
Seq: GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGtCACCAGTTCGATTCCGGTAGTCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
chrI.trna30 (2940647-2940722)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (2940680-2940682)	Score: 91.83
Seq: GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGtCACCAGTTCGATTCCGGTAGTCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
chrI.trna33 (2940956-2941031)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (2940989-2940991)	Score: 91.83
Seq: GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGtCACCAGTTCGATTCCGGTAGTCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
chrI.trna41 (3251574-3251499)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (3251541-3251539)	Score: 91.83
Seq: GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGtCACCAGTTCGATTCCGGTAGTCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
chrI.trna18 (722742-722818)	Length: 77 bp
Type: Trp	Anticodon: CCA at 35-37 (722776-722778)	Score: 74.44
Seq: AGGGGTGTAGCTCcAATTGGCAGAGCAGCGGATTCCAAATCCGCGTGtTGGGAGTTCGAATCTCTCCACCCCTGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna59 (3037612-3037536)	Length: 77 bp
Type: Trp	Anticodon: CCA at 35-37 (3037578-3037576)	Score: 74.44
Seq: AGGGGTGTAGCTCcAATTGGCAGAGCAGCGGATTCCAAATCCGCGTGtTGGGAGTTCGAATCTCTCCACCCCTGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna82 (1135115-1135031)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1135081-1135079)	Score: 60.09
Seq: GGAGGGGTTCCCGAGTGGCcaAAGGGAGCAGACTGTAAATCTGCCGGCTCCGCCTtCGATGGTTCGAATCCGTCCCCCCCCACCA
Str: >>.>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<.<<....
                    
chrI.trna42 (3251451-3251367)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (3251417-3251415)	Score: 65.45
Seq: GGAGGGGTTCCCGAGTGGCcaAAGGGAGCAGACTGTAAATCTGCCGGCTCCGCCTtCGATGGTTCGAATCCGTCCCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>.>..<.<...>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna24 (1535714-1535790)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (1535748-1535750)	Score: 88.63
Seq: GCGTCCGTAGCTCAGTTGGTtAGAGTATCGCCTTGACATGGCGGGGGtCGGTGGTTCGAGTCCACTCGGACGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna25 (1535826-1535902)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (1535860-1535862)	Score: 90.33
Seq: GCGTCCATAGCTCAGTTGGTtAGAGTACTACCTTGACATGGTAGGGGtCGGTGGTTCGAGTCCACTTGGACGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna12 (179755-179830)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (179788-179790)	Score: 95.98
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCACTGGTTCGAACCCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna16 (719024-719099)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (719057-719059)	Score: 95.98
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCACTGGTTCGAACCCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna39 (3261378-3261303)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (3261345-3261343)	Score: 95.98
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCACTGGTTCGAACCCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrI.trna64 (2952344-2952269)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (2952311-2952309)	Score: 95.98
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCACTGGTTCGAACCCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chrII.trna3 (307434-307509)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (307467-307469)	Score: 95.98
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGtCACTGGTTCGAACCCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.